Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081247 Similarity: 0.973 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA081247
Gene: PLEKHA2
MFE: -37.504
ENS: 0.910
Length: 113.
Predicted Ligands:
FMN - 8/20
TPP - 8/20
purine - 2/20
 RS: URS0000AB90F6_1423828
MFE: -27.497
Ligand: FMN
Species: Lactobacillus kefiranofaciens subsp. kefirgranum DSM 10550 = JCM 8572 FMN riboswitch (RFN element)
 RS: URS0000ABC548_748671
MFE: -25.485
Ligand: FMN
Species: Lactobacillus crispatus ST1 FMN riboswitch (RFN element)
 RS: URS0000C7A333_1224163
MFE: -37.468
Ligand: TPP
Species: Corynebacterium maris DSM 45190 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081247 URS0000AB90F6_1423828 URS0000ABC548_748671 URS0000C7A333_1224163
Length 113. 113. 113. 114.
Similarity - 0.973 0.972 0.971
Ensemble Norm 0.910 - - -
MFE -37.504 -27.497 -25.485 -37.468
Ligands - FMN FMN TPP
Gene PLEKHA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 3.006 5.
Length SE - 0. 0. 1.
Lev Distance - 37. 37. 36.
UBS 7. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 1. 1. 1. 2.
H 5. 5. 5. 4.
BL 1. 1. 0. 2.
BR 1. 1. 0. 1.
UN 0.195 0.257 0.274 0.211

Sequences

Field Description
UTR seq + 25 ggggcaccgaccccgcaacgacugcccgggcugcgggaggggaggagagcagagaacguccccagggugaugugagcagagcccaggaATGCCTTATGTGGATCGGCAGAACC
UTR dot + 25 ((((……))))……….((((…..)))).(((((.(………..).))))).((((..((….))..))))…..((((………..))))…..
RS 1 seq UAUUGUCUUCAGGGCAGGGUGAAAAUCCCGACCGGCGGUUAGAGUCCGCGACCCACGUAAGUGGUGGAAUCGUUAGAUACCGAUAGUUAAAGUCUAGAUGGAAGAAGACAGAC
RS 1 dot …………((..(((…….)))..)).((((…….))))…((((….))))(((.(((….))).)))………((((……….))))….
RS 2 seq UAUUGUCUUCAGGGCAGGGUGAAAGUCCCGACCGGCGGUGAAAGUCCGCGACCCACGUCAGUGGUUGAAUCGUUAGAUACCGAUAGUUAAAGUCUAGAUGGAAGAAGACAGGC
RS 2 dot …………((..(((…….)))..)).((((…….))))…((((….))))….((((……..))))…….((((……….))))….
RS 3 seq AGACACACCCACGGGCGCCCGAGGCAUCGGGCUGAGAUCGCGCUGUAACCCGCGCGAGACACCGUUCGAACCUGUCCGGCUAGCACCGGCGAAGGAAGUGAGGGCAUGCCGCCA
RS 3 dot …………….((((((….))))))…..((((((……..))))))((((..((….)).))))((((..((.((.((…….))..))))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table