Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081502 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA081502
Gene: PLRG1
MFE: -19.007
ENS: 0.934
Length: 88.
Predicted Ligands:
guanidine - 12/20
zmp-ztp - 2/20
glycine - 2/20
 RS: URS00021EDF96_12908
MFE: -35.310
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS00019FD161_2653126
MFE: -34.026
Ligand: zmp-ztp
Species: Aeromicrobium sp. 9AM pfl
 RS: URS00021EE003_12908
MFE: -38.465
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081502 URS00021EDF96_12908 URS00019FD161_2653126 URS00021EE003_12908
Length 88. 89. 88. 88.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.934 - - -
MFE -19.007 -35.310 -34.026 -38.465
Ligands - guanidine zmp-ztp guanidine
Gene PLRG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 11.005 9.001
Length SE - 1. 0. 0.
Lev Distance - 25. 24. 25.
UBS 6. 5. 7. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 0.
ILR 1. 1. 2. 1.
H 2. 2. 2. 2.
BL 1. 1. 2. 1.
BR 3. 2. 1. 1.
UN 0.193 0.180 0.125 0.159

Sequences

Field Description
UTR seq + 25 ggcggguacugcguuagugauuagaguuucuucccugccggaggugggauacacgguagcaucATGGTCGAGGAGGTACAGAAACATT
UTR dot + 25 .((((…))))………….((((((((((.((((..((((………….)))).)))).).)))…..))))))…
RS 1 seq AACCAUCUGCCACCGGGUAGAGAGAUGCUAUACGCAUCCGCCGCACAUCGUUAGGUCUUAGAAGAUGUGCCGACGGGUGCGUUGUUUUU
RS 1 dot ..(..((((((….))))))..)…….((((((((((.(((((((…………..))))))).).)))))))))…….
RS 2 seq GCAGUCGGUCGCGACUGGCGUUGAGGUGGGUACCACCGGGGAGCGACUGCAACACCGGACAUCGGGACCGUUCGCCUGGGCCCCACGU
RS 2 dot .((((((….))))))……..(((((..(((..((.(((((…….(.(((…..))))..))))).)))))..)))))..
RS 3 seq UUGAUGUUGCCGCCGGGUAACAAGCAUCAAAUGCACCAGCCCCAUGUCGUUAGGCCUUAGAAGACAUGGCAGGCCGGUGCAUUUUUUU
RS 3 dot ….(((((((….)))))))……(((((((((.((((((((((…………..)))))))..))).)))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table