Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081654 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA081654
Gene: PLXNC1
MFE: -36.
ENS: 0.934
Length: 84.
Predicted Ligands:
cyclic-di-GMP - 14/20
homocysteine - 2/20
cobalamin - 1/20
RS: URS0000D85077_1111071
MFE: -19.692
Ligand: homocysteine
Species: Rhodoferax antarcticus ANT.BR S-adenosyl-L-homocysteine riboswitch
RS: URS0000ABA675_12908
MFE: -24.029
Ligand: cyclic-di-GMP
Species: unclassified sequences Cyclic di-GMP-II riboswitch
RS: URS0000D90371_1121476
MFE: -18.794
Ligand: cyclic-di-GMP
Species: Dethiosulfatibacter aminovorans DSM 17477 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081654 URS0000D85077_1111071 URS0000ABA675_12908 URS0000D90371_1121476
Length 84. 83. 83. 84.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.934 - - -
MFE -36. -19.692 -24.029 -18.794
Ligands - homocysteine cyclic-di-GMP cyclic-di-GMP
Gene PLXNC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.025 8.029 1.032
Length SE - 1. 1. 0.
Lev Distance - 21. 19. 23.
UBS 5. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 3. 3. 1. 3.
H 1. 1. 1. 1.
BL 2. 1. 3. 1.
BR 1. 1. 2. 1.
UN 0.036 0.193 0.205 0.214

Sequences

Field Description
UTR seq + 25 agccaacugggaucuuugguuacaagugaagguuauuugauuuagcuuucacuuguaaaATGGAGGTCTCCCGGAGGAAGGCGC
UTR dot + 25 .(((..((((((.((((.(((((((((((((((((…….)))))))))))))))..)).))))..))))))…..)))..
RS 1 seq CCCUCCAAGGAGCGUUGCAGCGAAACCAAGAUUUCGUCAGGCUUGGAAUGUGUUUGAGACCGCCGCAACGACGCUCACCUGCU
RS 1 dot ………(((((((((.(((….((((((((((…….))))))…))))….))).)))…))))))…….
RS 2 seq AUAAUUUGGUGGGCGUUGAUGUGCCCUUUGUAUCUGGUCGCUUGAGGGGUACGGAGCCAAUAGCGAAACCGCCGCCGUCAUAG
RS 2 dot …….(((((.(((((.((.((..(((((((((..((….)).))))))))))))).)))))…)))))……….
RS 3 seq GCUUGAAUCGGGAACGUUGAACCAGACGGAGUAUUUGGACACUUUCCCUCUGGUGAGUUAAUAGUGUAACCGACCUUUUAUUAA
RS 3 dot …….((((..(((((((((((((.((((…………)))).))))))…)))))…))..))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table