Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081675 Similarity: 0.957 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA081675
Gene: PMEPA1
MFE: -72.330
ENS: 0.821
Length: 169.
Predicted Ligands:
lysine - 11/20
glucosamine - 5/20
zmp-ztp - 1/20
 RS: URS0000C704D6_1437444
MFE: -73.588
Ligand: zmp-ztp
Species: Hydrogenophaga sp. T4 ZMP/ZTP riboswitch
 RS: URS0000D7E0B2_1214604
MFE: -49.068
Ligand: glucosamine
Species: Tumebacillus algifaecis glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C54FE9_1796616
MFE: -51.962
Ligand: lysine
Species: Blautia sp. YL58 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081675 URS0000C704D6_1437444 URS0000D7E0B2_1214604 URS0000C54FE9_1796616
Length 169. 167. 169. 170.
Similarity - 0.957 0.954 0.953
Ensemble Norm 0.821 - - -
MFE -72.330 -73.588 -49.068 -51.962
Ligands - zmp-ztp glucosamine lysine
Gene PMEPA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 15.003 11.004
Length SE - 4. 0. 1.
Lev Distance - 45. 55. 56.
UBS 11. 13. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 3.
ILR 1. 4. 3. 2.
H 4. 4. 4. 4.
BL 5. 5. 2. 3.
BR 4. 3. 3. 3.
UN 0.095 0.084 0.148 0.159

Sequences

Field Description
UTR seq + 25 uggucguccuccuuggguucgggugaaagcgcuuggggguucagugggccaugauccccgagcugcuggagaacugaaggcggacagucuccugcgaaaccagcggagcuggaguuuguucagaucaucaucaucgugguggugATGATGGTGATGGTGGTGGTGATCA
UTR dot + 25 …..((((.((((.(((((…….((((((((((((.(((……..)))))))))))).)))…))))).)))).))))…((((.((…….))))))(((((…..)))))((((((((((((((.((….)).))))))))))))))……..
RS 1 seq GACCCCGUGCGCAACUGGCGAUAGGCACUCAAGGUGCGGGGCUCGCUACCCCACCUUCGGUGCUGACGUGGCCCCCCUGCCCCAUCCGGGACACCAGGGACAACCACUGGGAAGCGUGCCGCCUGGCUGCCAAGACAGGUGAUCAGCCGUUCGCCUGGGCAGCCCCU
RS 1 dot …((((((.(((…(((.((.((((((.((((((.(((……..))))))))).))))))…)).)))….)))..))..))))…((((((….)).))))…(((…)))..(((((((….(((((((……..))))))))))))))…
RS 2 seq CAUAUUGACCAAGCGCCUGAACUGGACGCACGGACGGAAACAGCGAGCCAGUUGACGAGGUGGAGGAGUAUCGAACAUCGGCGGAUGCCUCCCGGUGUAUAGCCGCACCGAAAGAGCGUUUUCGAAAUCCGACAGGUGACUGACGGGACAAGGAACGUUUUGGCUACUA
RS 2 dot ………….((((((((((((.(((………….)))..))))))..).)))))..((((((((………..))))).)))((((((……))))))..((((((((((…..((((.(((….))).))))….))))))))))……..
RS 3 seq CAGAAUGAUAGAGGUGCAGGUUUCAAGAGUAUUUCCGCAGAAAAGGCCGGGCGGCCGCCGGAAAGAAAGGGGAAGCUGCCGAAGGGAUGGACACCUGCCCGGGUGUCUGUUUCUGGGACGCCGCAUAAGAUGCGUCGUACUGUCACUGGAAGUGGAGCGCUAUCAUCUUG
RS 3 dot ………….(.((((.((((…….(((((((……((((….)))))).)))))……)))).)))))..((((((((((((((….))))))))))))))((….))……(((((((..((((.((….))))))..)))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table