Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081676 Similarity: 0.993 Similarity: 0.991 Similarity: 0.990
UTR: 5HSAA081676
Gene: PMF1
MFE: -11.178
ENS: 0.986
Length: 48.
Predicted Ligands:
SAM - 8/20
unknown - 7/20
preQ_1 - 2/20
RS: URS0000C526CF_1227363
MFE: -9.360
Ligand: preQ_1
Species: Lactobacillus saerimneri 30a PreQ1 riboswitch
RS: URS0000D6BBBA_12908
MFE: -12.930
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
RS: URS0000DAC2A0_1904966
MFE: -14.112
Ligand: cobalamin
Species: Ornithinimicrobium sp. CNJ-824 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081676 URS0000C526CF_1227363 URS0000D6BBBA_12908 URS0000DAC2A0_1904966
Length 48. 48. 49. 49.
Similarity - 0.993 0.991 0.990
Ensemble Norm 0.986 - - -
MFE -11.178 -9.360 -12.930 -14.112
Ligands - preQ_1 unknown cobalamin
Gene PMF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 1.002 2.002
Length SE - 0. 1. 1.
Lev Distance - 9. 11. 12.
UBS 3. 2. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 1.
UN 0.188 0.250 0.143 0.143

Sequences

Field Description
UTR seq + 25 agauuuggagguucaacuucaacATGGCCGAAGCAAGTAGCGCCAATC
UTR dot + 25 ….((((((……))))))..((((….((…..))))))…
RS 1 seq ACACAGGUGGUUCGCAACCAUCCCACCUUUAUAAAAAACUAAGGAGAG
RS 1 dot …..(((((((…)))))))…((((………..))))….
RS 2 seq GGUUGGGCAGGUAACUGCUUUCAAGUUUUGAGCUUAAGGGUGGAAAGCU
RS 2 dot ….((((((….))))))…((((((..(((….)))..))))))
RS 3 seq GAAGUCCGGUGAGAACCCGGCACUGUCCCGCAACGGUGGAGCCCGGCGA
RS 3 dot ..(((((((…….)))).)))….(((..(((……)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table