Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081677 Similarity: 0.990 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA081677
Gene: PMF1_0
MFE: -11.178
ENS: 0.964
Length: 53.
Predicted Ligands:
unknown - 12/20
glutamine - 6/20
SAM - 1/20
RS: URS0000D6ABFA_1144317
MFE: -19.793
Ligand: unknown
Species: Acidovorax sp. CF316 nhaA-I RNA
RS: URS0000E5FFAF_121290
MFE: -18.641
Ligand: unknown
Species: Hyphomicrobium sulfonivorans nhaA-I RNA
RS: URS0000D6CABD_12908
MFE: -11.573
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081677 URS0000D6ABFA_1144317 URS0000E5FFAF_121290 URS0000D6CABD_12908
Length 53. 53. 54. 52.
Similarity - 0.990 0.990 0.989
Ensemble Norm 0.964 - - -
MFE -11.178 -19.793 -18.641 -11.573
Ligands - unknown unknown glutamine
Gene PMF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 7.004 1.
Length SE - 0. 1. 1.
Lev Distance - 12. 11. 13.
UBS 3. 4. 5. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 0. 2. 1. 0.
BR 0. 1. 1. 1.
UN 0.264 0.208 0.204 0.250

Sequences

Field Description
UTR seq + 25 caguuagauuuggagguucaacuucaacATGGCCGAAGCAAGTAGCGCCAATC
UTR dot + 25 ………((((((……))))))..((((….((…..))))))…
RS 1 seq GGGUGUACGCGCUACAGGGGCGCGGCAGGUUCAGCGUCGGUCGGGCCGCCACG
RS 1 dot …….((((((…..))))))((.(((((.((….)).)))))))….
RS 2 seq GGGUGUCACGCUGCGCAGUGCGGCGGGCAGGAAUGCGAUGGUCGGGCCGCCACG
RS 2 dot ……..((((((…..))))))(((.((..(((….).))..)))))…
RS 3 seq AUCGUUCAACCUGAUACAUUCAGGUCGCAAGUAAGCCGACUCGGAACGGAUC
RS 3 dot …((…((((((…..)))))).))…….(((……..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table