Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081722 Similarity: 0.987 Similarity: 0.984 Similarity: 0.977
UTR: 5HSAA081722
Gene: PMPCA
MFE: -2.514
ENS: 0.801
Length: 30.
Predicted Ligands:
SAM - 8/20
preQ_1 - 7/20
unknown - 2/20
RS: URS0000ABD446_1313296
MFE: -4.722
Ligand: preQ_1
Species: Paenibacillus uliginis N3/975 PreQ1 riboswitch
RS: URS000080E32E_119072
MFE: -6.098
Ligand: preQ_1
Species: PREQ1 RIBOSWITCH from Caldanaerobacter subterraneus subsp. tengcongensis (PDB 6VUH, chain A)
RS: URS000080E037_32630
MFE: -4.622
Ligand: preQ_1
Species: PreQ1 riboswitch from None (PDB 3K1V, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081722 URS0000ABD446_1313296 URS000080E32E_119072 URS000080E037_32630
Length 30. 32. 33. 34.
Similarity - 0.987 0.984 0.977
Ensemble Norm 0.801 - - -
MFE -2.514 -4.722 -6.098 -4.622
Ligands - preQ_1 preQ_1 preQ_1
Gene PMPCA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 2.009 2.003
Length SE - 4. 9. 16.
Lev Distance - 13. 12. 14.
UBS 2. 1. 1. 1.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0. 0.344 0.394 0.353

Sequences

Field Description
UTR seq + 25 gcaagATGAAGCGAAATACCTTAGTGGAAT
UTR dot + 25 ((……..))……((…..))…
RS 1 seq AGAGGUUCGUGAACUCCCUCUAUAAAAAACUA
RS 1 dot (((((………..)))))………..
RS 2 seq CUGGGUCGCAGUAACCCCAGUUAACAAAACAAG
RS 2 dot (((((……….)))))………….
RS 3 seq AGAGGUUCUAGCACAUCCCUCUAUAAAAAACUAA
RS 3 dot (((((…………)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table