Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081723 Similarity: 0.970 Similarity: 0.970 Similarity: 0.967
UTR: 5HSAA081723
Gene: PMPCA_0
MFE: -28.518
ENS: 0.821
Length: 121.
Predicted Ligands:
glycine - 7/20
TPP - 4/20
FMN - 3/20
 RS: URS0000ABB05A_245012
MFE: -31.892
Ligand: FMN
Species: butyrate-producing bacterium SM4/1 FMN riboswitch (RFN element)
 RS: URS0000AB63AC_717608
MFE: -31.892
Ligand: FMN
Species: Clostridium cf. saccharolyticum K10 FMN riboswitch (RFN element)
 RS: URS000229633E_2822368
MFE: -31.976
Ligand: glycine
Species: Lysobacter sp. CECT 30171 Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081723 URS0000ABB05A_245012 URS0000AB63AC_717608 URS000229633E_2822368
Length 121. 120. 120. 120.
Similarity - 0.970 0.970 0.967
Ensemble Norm 0.821 - - -
MFE -28.518 -31.892 -31.892 -31.976
Ligands - FMN FMN glycine
Gene PMPCA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.001 7.030
Length SE - 1. 1. 1.
Lev Distance - 38. 38. 39.
UBS 11. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 3.
ILR 5. 5. 5. 5.
H 2. 1. 1. 1.
BL 4. 5. 5. 2.
BR 4. 4. 4. 3.
UN 0.198 0.175 0.175 0.025

Sequences

Field Description
UTR seq + 25 aaagcgcgugccugaacgccuugggccgucggcgagggggaggggaagccgugggcggaagcggaagugacgacugaagcggggcggagacgcaagATGAAGCGAAATACCTTAGTGGAAT
UTR dot + 25 …..((((..(((..(..(((.((((((((.(.(.((……….)).).).))…))))………)).)))..)..)))..))))…………….((…..))…
RS 1 seq AACUAUCUUCGGGGCAAGGUGGAAUCCCUGACCGGCAGUGAUAGUCUGCGAACUGCAUCAGCAGCCGAAACGGUGAAAUCCCGUUGCCGACGGUAAUAGUCCGGAUGAGAGAAAAUAUGA
RS 1 dot .(((((..(((.(((((.(.(((.((((….((((.((((((((……)))..)))).).))))….)).))..)))).)))))..)))..)))))………………..
RS 2 seq AACUAUCUUCGGGGCAAGGUGGAAUCCCUGACCGGCAGUGAUAGUCUGCGAACUGCAUCAGCAGCCGAAACGGUGAAAUCCCGUUGCCGACGGUAAUAGUCUGGAUGAGAGAAGAUAUGA
RS 2 dot .(((((..(((.(((((.(.(((.((((….((((.((((((((……)))..)))).).))))….)).))..)))).)))))..)))..)))))………………..
RS 3 seq UGUGACAACUCUGGAGAGACCGGUUCAAUCCGGCGCCGAAGGUGCACGAAGCAGCCCUCCCCCCGCGGCCGACAUGGCGCACGCUUCCGAACUCUCAGGCAAAAGGACAGAGGGGCGCCC
RS 3 dot .(((.(..((((((((((..(((…….(((((((((.(((((…..))).)).))…………….))))).))…)))..)))))………..)))))..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table