Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081800 Similarity: 0.975 Similarity: 0.975 Similarity: 0.968
UTR: 5HSAA081800
Gene: PNLIPRP1
MFE: -28.418
ENS: 0.921
Length: 113.
Predicted Ligands:
TPP - 12/20
tetrahydrofolate - 3/20
preQ_1 - 3/20
 RS: URS0000C6D53E_1487921
MFE: -30.034
Ligand: tetrahydrofolate
Species: Clostridium sp. HMP27 THF riboswitch
 RS: URS0000C65F26_1423739
MFE: -24.220
Ligand: tetrahydrofolate
Species: Lactobacillus diolivorans DSM 14421 THF riboswitch
 RS: URS00023198A0_1262932
MFE: -19.683
Ligand: SAM
Species: Prevotella sp. CAG:604 SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081800 URS0000C6D53E_1487921 URS0000C65F26_1423739 URS00023198A0_1262932
Length 113. 112. 113. 113.
Similarity - 0.975 0.975 0.968
Ensemble Norm 0.921 - - -
MFE -28.418 -30.034 -24.220 -19.683
Ligands - tetrahydrofolate tetrahydrofolate SAM
Gene PNLIPRP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 12.001 8.011
Length SE - 1. 0. 0.
Lev Distance - 28. 30. 40.
UBS 5. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 0.
ILR 1. 2. 4. 3.
H 2. 1. 1. 2.
BL 1. 3. 1. 2.
BR 1. 2. 0. 0.
UN 0.115 0.098 0.088 0.221

Sequences

Field Description
UTR seq + 25 gagguaaacaguacugaaguccagggcgucggugcucacugcucuggcaaugcccggugagacugaauuauguuuaaauuuauuguagATGCTGATCTTCTGGACAATCACAC
UTR dot + 25 ..((((…..))))…((((((((.((((((((((((((….(((…))))))))))……………………….))))))).))))))))……..
RS 1 seq GUUAGAGUAGGUGAUUGCGCGUGAAGUGCUAGAUGGACAGGAAGUUGCCACUAGACGAAGAGAUUUUAAUGUUAUUUAAAGUUUCGCGAUGCAGUUGCCGCAUUCCGCUAAC
RS 1 dot ….((((.(((((((((((((((((((((((.(((.(((….)))))))))).))……………………))))))).))))))))))..))))…….
RS 2 seq UAUGGAGUAGGAUUCAACGCGUUAAGUGUCGAAGGAACGGAAUGUGAACUUCGAACGAAAAGUAAUGAUGCGACUUAUUAAUUACUUGCGGUGUUGUUUCCGCAUUCGCCAAU
RS 2 dot ….((((.(((..((((((..((((((((((((…………..))))))……………………….))))))..))))))..)))..))))……
RS 3 seq AAUAAGCAUUAAGAGUUGCCCAGUUGUGGCACACCAACCGAGUUUCGCAUAGAGAUAACCACGGUGGUAAAAGAAUGUGUAAGUGUUUAACAACUUAAAAUAAUUAUCUUUAU
RS 3 dot …..(((……..)))..((((((((((((((.((((.(((((…..)))))…..)))))))…………..)))))..))))))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table