Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081864 Similarity: 0.967 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA081864
Gene: PNPLA4
MFE: -29.756
ENS: 0.937
Length: 145.
Predicted Ligands:
FMN - 11/20
cobalamin - 5/20
SAM - 3/20
 RS: URS0000AB7750_1033802
MFE: -49.254
Ligand: FMN
Species: Salinisphaera shabanensis E1L3A FMN riboswitch (RFN element)
 RS: URS000231E0C4_102125
MFE: -40.884
Ligand: cobalamin
Species: Xenococcus sp. PCC 7305 Cobalamin riboswitch
 RS: URS0000C6AA4D_983917
MFE: -65.035
Ligand: FMN
Species: Rubrivivax gelatinosus IL144 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081864 URS0000AB7750_1033802 URS000231E0C4_102125 URS0000C6AA4D_983917
Length 145. 146. 144. 145.
Similarity - 0.967 0.963 0.963
Ensemble Norm 0.937 - - -
MFE -29.756 -49.254 -40.884 -65.035
Ligands - FMN cobalamin FMN
Gene PNPLA4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 10.001 10.003
Length SE - 1. 1. 0.
Lev Distance - 41. 43. 45.
UBS 11. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 5. 6. 5. 5.
ILR 4. 5. 5. 3.
H 1. 1. 1. 1.
BL 4. 4. 2. 5.
BR 4. 3. 5. 6.
UN 0.069 0.041 0.035 0.014

Sequences

Field Description
UTR seq + 25 aaggcacuuccggggcacagaaaaugaggauuauuaaaggaauguaaccaauuuaccuacaaguuugccgaagaaaucagaaggcagucuuucggggcaguaacgcccgguuaugacuucATGGCCCGACTAAGAAGTGGGATGG
UTR dot + 25 ….((((((((((.((…….(((((.((((….((..(((.((…….(((..(((.(((((………….))))).)))..)))…)).))).))….))))))))))).))))…..))))))……
RS 1 seq CACCGUCUUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUAUGUCGUACUCGACGAGCCCGCGAGCGCCUCGAUUCAUCGUCGAGGGUCAGCAGAUCUGGUGCGAUGCCAGAGCCGACGGUUAGAGUCCGGAUGAAAGAAGACGCAC
RS 1 dot …(((((((….((((.(.(((….((..(((((((..((((((((.((…….((..((.(((((((…..)))))))))..))…)).)))))))))))…))))..))))).).))))…….)))))))…
RS 2 seq AGUGUUGGGUCGCUAGCCGGUUCUAAUGGGGAGCAUCCAUUAGAGUUAAUGGGGAAAGUUUGGUGCAAAUCCAACGCUGUCCCGCAACUGUGAUCGAGGGAAAUUCCUCUAAGCCAGAACGCCCGCCGACAAAUUAGCGCCAAC
RS 2 dot .((((((((((((..((..(((((…((((((..(((((((.(((…((((((.(((((((…….)))).))).)))).))))).))))….)))..))))))……)))))))..)).)))…)))))))….
RS 3 seq ACACGUCUUCAGGGCGGGGUGGAACUCCCCACCGGCGGUAGGCGGCUUCGGCCGCGAGCCCGCGAGCGCCCGGCGCGAGCCGGGGUCAGCAGAUCUGGUGCGAAGCCAGGGCCGACGGUCACAGUCCGGAUGAAAGAAGACGUGC
RS 3 dot .(((((((((….((((.((((……..(((.((((….(((((((((((.((..(.((..((.((((((….))))))))..)).).)))))).)))))))…)))).))))).)).))))…….))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table