Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081865 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA081865
Gene: PNPLA5
MFE: -49.167
ENS: 0.796
Length: 122.
Predicted Ligands:
TPP - 17/20
lysine - 1/20
homocysteine - 1/20
 RS: URS0000DA9A49_546364
MFE: -44.101
Ligand: TPP
Species: Amycolatopsis australiensis TPP riboswitch (THI element)
 RS: URS0000DA3C63_1904969
MFE: -50.848
Ligand: TPP
Species: Saccharomonospora sp. CUA-673 TPP riboswitch (THI element)
 RS: URS0000B86B1A_475083
MFE: -44.642
Ligand: TPP
Species: Roseovarius aestuarii TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081865 URS0000DA9A49_546364 URS0000DA3C63_1904969 URS0000B86B1A_475083
Length 122. 122. 122. 122.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.796 - - -
MFE -49.167 -44.101 -50.848 -44.642
Ligands - TPP TPP TPP
Gene PNPLA5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.008 7.
Length SE - 0. 0. 0.
Lev Distance - 32. 35. 35.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 3.
ILR 3. 4. 2. 3.
H 3. 3. 4. 3.
BL 1. 2. 1. 2.
BR 1. 1. 0. 0.
UN 0.107 0.090 0.197 0.115

Sequences

Field Description
UTR seq + 25 auuugggcccagccccguccaaggcugcaucccggcccuaucccgggucacggagugacccuuccucgucccgaucaccccgcccgguccacccgccATGGGCTTCTTAGAGGAGGAGGGCA
UTR dot + 25 ….((((((((((……..)))))……)))))……(((((((…))))))).(((((.(((……….(((((((……)))..))))……..))).)))))..
RS 1 seq CAACACCAACGCGGGAGCUCGCGCCAUGGCGGGCUGAGAGGGCGACUUGCGUCACGCAGGCGUCGCCGACCGCAUGAACCUGACCGGGUAAUGCCGGCGUAGGGAGUGAAAGUCGUUGACGA
RS 1 dot ………(((…(((((((……)))))))……))).((((((…))))))(((((.((((..(((…((((.((((……))))..))))..)))…)))).))))).
RS 2 seq UGGUGUCCGCACGGGAGCCUGGUGGGCUGAGAGGGAGCACCGGCCGCGACGUCCGCGGCCCGACUCCGACCGUGGAACCUGAUCCGGAUCAUGCCGGCGCAGGGAGCGUGAAUCGUAUGCAU
RS 2 dot ….((((((.(((….)))))))))……((((….(((((((…..)))))))…))))……….((((..((((……))))..))))..(((((…..)))))..
RS 3 seq GGGCGUACGCAGGGGAGUCUCAACCGAGAGACUGAGAGGCGAAUAGCAGCAAGGCUGCAGUGUCGCGACCCUUUGAACCUGACCCAGUUGAUACUGGCGUAGGAAGCUAAGGGCGCACAUCG
RS 3 dot …….(((…..((((((……))))))…..)))….(((((…))))).((((.(((.(((((….((((..(((((….)))))..))))…..))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table