Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA081976 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA081976
Gene: PNPLA6
MFE: -31.521
ENS: 0.951
Length: 97.
Predicted Ligands:
TPP - 8/20
purine - 3/20
glycine - 3/20
 RS: URS0000ABB411_688245
MFE: -37.715
Ligand: homocysteine
Species: Comamonas testosteroni CNB-2 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C31EA1_1284
MFE: -25.231
Ligand: SAM
Species: Staphylococcus hyicus SAM riboswitch (S box leader)
 RS: URS0000C7CF26_398843
MFE: -33.772
Ligand: TPP
Species: Rhodococcus kyotonensis TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA081976 URS0000ABB411_688245 URS0000C31EA1_1284 URS0000C7CF26_398843
Length 97. 98. 98. 96.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.951 - - -
MFE -31.521 -37.715 -25.231 -33.772
Ligands - homocysteine SAM TPP
Gene PNPLA6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 2.008 6.001
Length SE - 1. 1. 1.
Lev Distance - 32. 33. 32.
UBS 8. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 2. 1.
H 3. 3. 3. 3.
BL 2. 3. 3. 0.
BR 3. 3. 2. 3.
UN 0.031 0.082 0.122 0.062

Sequences

Field Description
UTR seq + 25 acggguuccuucgacuccuugauuucccaggacuccgggcuaccagaucggccguccagcuggaaucaaccgATGGGGACATCGAGTCACGGGCTGG
UTR dot + 25 .((((.((((((((….))))……)))).))))((((……..))))..((((((.(…..(((((((….))))).))..).))))))
RS 1 seq CCAUCCGAGGAGCGUUGCAGCGUUCCCCCGGCCAGCCAUGAGCUGGUCUGCGCGGGGCGUGAGGCUCGGAUUUCAUCCCGCAACGACGCUCGCCCACG
RS 1 dot ….(((.(((((((….)))))))..)))(((((…..)))))..((.((.(((((((..((..((((…)))).))..).)))))))).))..
RS 2 seq UACUUAUCCAGAAUGGUGGAGGGACAGGCCCUUUGAAGCCAGGCAACCUUUUAAGUUAGGUGCUAAUUCCUGCAGGUGACAUGCCUGAGAGAUGAGUC
RS 2 dot ……….(..((((((((((…..))))))…))))..).((((……..))))(((.(((.((.(((((…..))))))).))).))).
RS 3 seq GCAAUCGACACGGGGUGCCGCUGCACGGCGGCUGAGAACACACCCGUCGAACCUGAUCUGGCCAGCACCAGCGUAGGGAUGUCUAUGUCUGAGCUG
RS 3 dot ….(((((..(((((((((((….))))))…….)).)))))))).((……)).((((..(((((((((….)))))).))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table