Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082032 Similarity: 0.982 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA082032
Gene: PNPO
MFE: -35.372
ENS: 0.979
Length: 90.
Predicted Ligands:
SAM - 12/20
glycine - 5/20
TPP - 2/20
 RS: URS0000AB260C_266940
MFE: -34.435
Ligand: SAM
Species: Kineococcus radiotolerans SRS30216 SAM riboswitch (S box leader)
 RS: URS0000D852C6_1214787
MFE: -28.346
Ligand: glycine
Species: Paracoccus sediminis Glycine riboswitch
 RS: URS000231D712_1123404
MFE: -24.203
Ligand: SAM
Species: Tissierella praeacuta DSM 18095 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082032 URS0000AB260C_266940 URS0000D852C6_1214787 URS000231D712_1123404
Length 90. 89. 89. 90.
Similarity - 0.982 0.980 0.979
Ensemble Norm 0.979 - - -
MFE -35.372 -34.435 -28.346 -24.203
Ligands - SAM glycine SAM
Gene PNPO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.008 7.015 3.
Length SE - 1. 1. 0.
Lev Distance - 22. 24. 28.
UBS 6. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 0.
ILR 0. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 2. 1. 2.
BR 3. 3. 2. 2.
UN 0.244 0.157 0.124 0.233

Sequences

Field Description
UTR seq + 25 guccagggugagaaauugguuccgaacucaaaggaacccagugccgggccacagccgggucacguATGACGTGCTGGCTGCGGGGCGTCA
UTR dot + 25 ……………..((((((………))))))..(((((.(((….))).)).)))…((((((.(((….))).))))))
RS 1 seq UCGCCAUCCAGAGCGGCCGAGAGACCCGGCUCGUCGACGCCGCAGCAACCUCCCCCCGGGGCAGGUGCUCCCGCCGGGACCGAUGGGAA
RS 1 dot …………(((((((((((……))).)))..))))).((.(((((((….))).))))))(((((.((….)).))))).
RS 2 seq CAUCGGAAUUCGGGAGAAGCUGGCCCGCGCCAGUGCCGAAGGAGCAGCCGCCCCGGCGAACUCUCAGGCAGAAGGACCGUUUUCCGCCA
RS 2 dot ……..(((((…..((((((….)))))).)))))((((..((((…))))…))))..(((.(((((….))))).))).
RS 3 seq UCCUUAUCAAGAGUUAGGGUAGAGAAUUAGCUCUAUGACCCUACGCCAACCUGCCAUUAGGUAAGGUGGUUCUGCUAAUGCCGAUAAGAU
RS 3 dot …………..((((((((((……))))…)))))).(((.(((((((….)))).))))))((.((….)).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table