Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082034 Similarity: 0.977 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA082034
Gene: PNPT1
MFE: -41.103
ENS: 0.
Length: 112.
Predicted Ligands:
TPP - 15/20
methionine - 3/20
SAM - 1/20
RS: URS0000D88371_1881059
MFE: -36.038
Ligand: TPP
Species: Aurantimonas sp. USBA 369 TPP riboswitch (THI element)
RS: URS0000C2B8BF_1196322
MFE: -25.587
Ligand: TPP
Species: Clostridium sp. Maddingley MBC34-26 TPP riboswitch (THI element)
RS: URS0000C5E7B3_1486262
MFE: -28.784
Ligand: TPP
Species: Martelella endophytica TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082034 URS0000D88371_1881059 URS0000C2B8BF_1196322 URS0000C5E7B3_1486262
Length 112. 112. 110. 114.
Similarity - 0.977 0.972 0.972
Ensemble Norm 0. - - -
MFE -41.103 -36.038 -25.587 -28.784
Ligands - TPP TPP TPP
Gene PNPT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.018 3.010 12.
Length SE - 0. 4. 4.
Lev Distance - 29. 31. 27.
UBS 10. 9. 9. 11.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 0.
ILR 4. 3. 4. 3.
H 3. 2. 2. 3.
BL 2. 3. 2. 5.
BR 3. 4. 3. 3.
UN 0.036 0.170 0.136 0.035

Sequences

Field Description
UTR seq + 25 ggaaacgaaacuccaucaggcuccgccccacggucugcggagugagccaaucagggcacagccugcguugaccgcgugccgggugucATGGCGGCCTGCAGGTACTGCTGCT
UTR dot + 25 (((……..)))..(((((((((((((.((((((((((..((.(((……))).))..)))))..))))).)….))))…..)).))))))(((……)))..
RS 1 seq CCCAUCGAACAGGGGUGCUCCGUAUCGCCGGGGCUGAGAGGAAGGCGUCAGGCCUUCAAACCCUCAAGCUGAUCUGGGUAAUGCCAGCGGAGCGAGUUAAGCCAUGUUUUCA
RS 1 dot (((……..))).((((((((((.(((.((((((((.(((((((…..))))))…).)))).))….)).))).))….))))))))………………
RS 2 seq AAUAAAGGCUAGGGGUGCCAAUUUAAGUUGGCUGAGAGAGGCUGUAUCUGCUUUAACUCUUUUGACCUGAUGUGGCUAAUACCACCGUAGGGAAGCAAUAAAAUUGUGUU
RS 2 dot ……..((((((((((((..(((.(((((..(((.(((((…….)))))..)))..))))).)))..))))….))).)).)))….(((((…)))))…
RS 3 seq CCACAUUCACAGGGGUGCUCCGUAUCGCCGGGGCUGAGAUUGAAGACGCCAUGUCUUCUGACCCUUUAGCUGAUCUGGGUAAUGCCAGCGGAGCGAGGUAAAAUGUUUUCCGGU
RS 3 dot ((.(……..)))((((((((((.(((.((((((((.((((((((…..)))))).))…))))))….)).))).))….)))))))).((.(((….)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table