Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082087 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA082087
Gene: POLA1
MFE: -8.657
ENS: 0.926
Length: 48.
Predicted Ligands:
glutamine - 13/20
unknown - 6/20
preQ_1 - 1/20
 RS: URS0000D681E7_36809
MFE: -8.726
Ligand: unknown
Species: Mycobacterium abscessus DUF1646 RNA
 RS: URS0000C2DFB2_12908
MFE: -6.967
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000D6D34F_12908
MFE: -19.170
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082087 URS0000D681E7_36809 URS0000C2DFB2_12908 URS0000D6D34F_12908
Length 48. 48. 48. 49.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.926 - - -
MFE -8.657 -8.726 -6.967 -19.170
Ligands - unknown glutamine unknown
Gene POLA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 7.073 7.
Length SE - 0. 0. 1.
Lev Distance - 12. 12. 11.
UBS 5. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 1. 0. 0. 0.
H 2. 2. 2. 2.
BL 2. 1. 1. 1.
BR 1. 2. 1. 1.
UN 0.167 0.208 0.438 0.184

Sequences

Field Description
UTR seq + 25 gcggaaucgggagauucgggaccATGGCACCTGTGCACGGCGACGACT
UTR dot + 25 .(.(((((….))))).)(.((…(((….)))..)))…….
RS 1 seq GGUUGGGCGAAAGCUUCAAGGAUUCAGUUCUUCAAGGGGUGAGAAGAA
RS 1 dot ..((((((….))).)))…((((.((((…)))).))))…..
RS 2 seq AUCGUUGGACUAAAAGUCGGAAGUAAGCAAUCGCUGAAGCAACGCACU
RS 2 dot ….((.((((…)))).))….(((….)))………….
RS 3 seq GGGUGCCAUAUGAAAAUGUGGCAGGUAUGGUGAAGGCCGGGCCGCCUCA
RS 3 dot …((((((((….))))))))(((.((((….)))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table