Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082246 Similarity: 0.974 Similarity: 0.974 Similarity: 0.972
UTR: 5HSAA082246
Gene: POLE2
MFE: -22.941
ENS: 0.945
Length: 105.
Predicted Ligands:
glycine - 5/20
TPP - 5/20
SAM - 3/20
 RS: URS00023243B6_869212
MFE: -58.682
Ligand: cobalamin
Species: Turneriella parva DSM 21527 Cobalamin riboswitch
 RS: URS0000DA7501_1891289
MFE: -19.199
Ligand: glycine
Species: Sporanaerobacter sp. PP17-6a Glycine riboswitch
 RS: URS0000C7581E_1487921
MFE: -19.007
Ligand: glycine
Species: Clostridium sp. HMP27 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082246 URS00023243B6_869212 URS0000DA7501_1891289 URS0000C7581E_1487921
Length 105. 105. 104. 105.
Similarity - 0.974 0.974 0.972
Ensemble Norm 0.945 - - -
MFE -22.941 -58.682 -19.199 -19.007
Ligands - cobalamin glycine glycine
Gene POLE2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 1.006 11.
Length SE - 0. 1. 0.
Lev Distance - 34. 34. 34.
UBS 6. 7. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 1. 2. 1. 2.
H 3. 2. 3. 3.
BL 2. 2. 1. 0.
BR 2. 2. 2. 0.
UN 0.133 0.114 0.212 0.124

Sequences

Field Description
UTR seq + 25 auguuuuuuaauuuuaaagagaaaacaaagggaauaacuugcuuuuaagcuauuggauaguguuacaauaauauuuuuaaATGGCGCCGGAGCGGCTGCGGAGCC
UTR dot + 25 .((((((((……….))))))))………….(((((…((((((.((.(((((((…))))))).)).))))))…)))))((((….))))
RS 1 seq AAGAGGAAGUCCGGUGAGAAUCCGGCGCUGACCCGCAACCGUGUUCGCCGGUAUGUAGGGGUAGGUUUAAACCUACCCCUACAUACCGGCGUAAGUCGGGAACUC
RS 1 dot ..(.((.(((((((…….)))).)))..)))….(((..(((((((((((((((((((((((….))))))))))))))))))))).))..)))……
RS 2 seq AUGAGGAUAAUGAGAGAUAUUCAUUUAGAAUGGCCGAAGAAGAAAUAUAGUGAUUUUGUCAAAUGACUAUAGAAGCUUUCAGGCAAAGGGAUUGUUAUCCGAUG
RS 2 dot ….(((((……..)))))……….(((((((……((((((.((((….)))).))))))…..)))).)))….((((….))))….
RS 3 seq UUGAAGGAUAUAAGAGACGACUUUAAAGGUGGCCGAAGGGACAAACUUUAUUUUAUCCCAAUGAAAUAAAGUGAAAUUCUCAGGCAAAAGAAUUAUAUCUGGAUA
RS 3 dot ((((((…………..))))))…..(((..((((….((((((((((((….))))))))))))….))))..)))…(((……)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table