Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082287 Similarity: 0.973 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA082287
Gene: POLK
MFE: -35.197
ENS: 0.832
Length: 121.
Predicted Ligands:
TPP - 16/20
methionine - 3/20
FMN - 1/20
 RS: URS0000C6EA61_1423718
MFE: -27.051
Ligand: FMN
Species: Lactobacillus agilis DSM 20509 FMN riboswitch (RFN element)
 RS: URS0000C662B1_1715693
MFE: -46.269
Ligand: TPP
Species: Phaeobacter sp. CECT 7735 TPP riboswitch (THI element)
 RS: URS0000C8347D_1449350
MFE: -44.871
Ligand: TPP
Species: Roseivivax halodurans JCM 10272 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082287 URS0000C6EA61_1423718 URS0000C662B1_1715693 URS0000C8347D_1449350
Length 121. 120. 121. 120.
Similarity - 0.973 0.972 0.971
Ensemble Norm 0.832 - - -
MFE -35.197 -27.051 -46.269 -44.871
Ligands - FMN TPP TPP
Gene POLK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.005 4. 3.001
Length SE - 1. 0. 1.
Lev Distance - 35. 36. 36.
UBS 10. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 4.
ILR 3. 2. 3. 2.
H 2. 2. 3. 2.
BL 3. 3. 2. 3.
BR 2. 2. 1. 3.
UN 0.066 0.133 0.058 0.

Sequences

Field Description
UTR seq + 25 agcugugcugcauucugggaagggcguugguccgucgcucgcgcagccuccugggaguuguagucgcgauccugagguaacggauaaguuuauaccATGGATAGCACAAAGGAGAAGTGTG
UTR dot + 25 .(((((((.((…….((.((((….)))).))))..)))))))(((((…..((((….((.((((…((((((……))…))))..)))).)))))))))))…….
RS 1 seq GUUUAUCUUCAGGGCAGGGUGAAAAUCCCGACCGGCGGUAAAAGUCCGCGACCCUUGUUUAAGGUUGAUUCGGUGCAAUUCCGAAACCGACAGUGAUAGUCUGGAUGGAAGAAGAUAGUA
RS 1 dot .((((((.((..((..(((…….)))..)))).)))))).(((((.(((.((((((…(((…(((((…….))))))))))))).)…))))))))…………..
RS 2 seq AAAGUCACGCAGGGGAGUCCCGCCUAUGGGACUGAGAGGCUGACAGGGUGAAAACCCGGUGACGCGACCCUUUGAACCUGACCCAGUUGACACUGGCGUAGGAAGCAAAAGGUUGUCGCAG
RS 2 dot …((((.((…..((((((……))))))…..)))))).((((….)))).(((((..((((.((((..((((..(((((….)))))..))))…)))).)))))))))..
RS 3 seq AUCUGUACCUCGGGGUGCCGGACGGUGCGCAUGCGCCCACGGCUGAGAUGCGGGAGAUCCCGCGAACCCGUUGAACCUGAACCGGGUAACACCGGCGGAGGGAAGGUUUUGCGGAACGAG
RS 3 dot .((((((.((((….((((…(((((….)))))..)))))))).))))))…..(((((((.((.((…(((…((((……))))…))))).)).)))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table