Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082294 Similarity: 0.991 Similarity: 0.989 Similarity: 0.987
UTR: 5HSAA082294
Gene: POLK_0
MFE: -7.637
ENS: 0.815
Length: 55.
Predicted Ligands:
glutamine - 13/20
unknown - 6/20
homocysteine - 1/20
RS: URS0000E5FF72_1801945
MFE: -22.581
Ligand: unknown
Species: Phenylobacterium sp. RIFCSPHIGHO2_01_FULL_70_10 sul1 RNA
RS: URS000080E144_305
MFE: -18.538
Ligand: homocysteine
Species: S-ADENOSYLHOMOCYSTEINE RIBOSWITCH from Ralstonia solanacearum (PDB 3NPQ, chain B)
RS: URS0000C6A044_12908
MFE: -9.166
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082294 URS0000E5FF72_1801945 URS000080E144_305 URS0000C6A044_12908
Length 55. 55. 54. 56.
Similarity - 0.991 0.989 0.987
Ensemble Norm 0.815 - - -
MFE -7.637 -22.581 -18.538 -9.166
Ligands - unknown homocysteine glutamine
Gene POLK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.021 2.008 1.028
Length SE - 0. 1. 1.
Lev Distance - 12. 13. 16.
UBS 5. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 2.
H 1. 1. 1. 1.
BL 2. 1. 2. 2.
BR 2. 2. 3. 2.
UN 0.309 0.164 0.222 0.143

Sequences

Field Description
UTR seq + 25 guagucgcgauccugagauaaguuuauaccATGGATAGCACAAAGGAGAAGTGTG
UTR dot + 25 …((.((.((((((..(((….)))..)).)))).))))…………..
RS 1 seq AACGGACCCGGCCCCGCCCGGGUGGCUCGGCCGGGCGCCUAUCCCCCGGACAACC
RS 1 dot ..(((….(((((((.(((((…))))).)))).)))……)))…….
RS 2 seq GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA
RS 2 dot ((((((.((((.(((…((….)).))))))).)).))))…………
RS 3 seq AUCGUUCAUUUUGAGUAUCUCAAAACGGAAGUAAGCGAAAGUUGAAGGAACGCAUG
RS 3 dot .((.(((((((((..(((.((……)).)))..)))))..)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table