Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082300 Similarity: 0.959 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA082300
Gene: POLK_1
MFE: -37.666
ENS: 0.867
Length: 158.
Predicted Ligands:
TPP - 8/20
FMN - 4/20
molybdenum - 3/20
 RS: URS0000C2C1EB_179993
MFE: -55.826
Ligand: TPP
Species: Fusarium langsethiae TPP riboswitch (THI element)
 RS: URS0000AB14F3_406817
MFE: -33.030
Ligand: molybdenum
Species: Xenorhabdus nematophila ATCC 19061 Moco (molybdenum cofactor) riboswitch
 RS: URS0000B9402B_40578
MFE: -39.239
Ligand: molybdenum
Species: Xenorhabdus beddingii Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082300 URS0000C2C1EB_179993 URS0000AB14F3_406817 URS0000B9402B_40578
Length 158. 159. 157. 157.
Similarity - 0.959 0.957 0.956
Ensemble Norm 0.867 - - -
MFE -37.666 -55.826 -33.030 -39.239
Ligands - TPP molybdenum molybdenum
Gene POLK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.004 5.003
Length SE - 1. 1. 1.
Lev Distance - 50. 55. 55.
UBS 13. 12. 12. 12.
BS 0. 0. 0. 0.
ILL 4. 4. 5. 4.
ILR 4. 5. 5. 5.
H 4. 3. 3. 3.
BL 3. 1. 3. 4.
BR 3. 3. 3. 2.
UN 0.057 0.069 0.121 0.115

Sequences

Field Description
UTR seq + 25 ucugggaagggcguugguccgucgcucgcgcagccuccugggaguuguagucgcgauccugagguaacggggguccagauuuuauggaaaugagcucaagaaagaaaagcaagucaaccaacgaauugaaaauATGGATAGCACAAAGGAGAAGTGTG
UTR dot + 25 …..((.((((….)))).)).(((.((..(((((..((((.((((….)))))))))))))..)).)))(((((((((..(((…((((((………..)))…))).)))..)))))…….))))..((((………)))).
RS 1 seq UCAUGCAUGAGCCGGUGCCCGGCCUCACUUCUUGUCAUCCCUCCAUAACUCAAUUCUGUUGACGAUGGAGAUGACGAUGAGAGGAGGGGACGUGGCUGAGAUUAUACGGCAAAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGUCCUCCUCCCUA
RS 1 dot …….((((((((…))))).)))(((.((((((((..(((((…(((((…)))))..))))))))))))).))).((((((((((((((((..((((..((((((…)))..)))..))))..))))……..))))))).)))))…
RS 2 seq AAUUAAUAUUAACUCCUAGCCUCUGUGUCUAAGUCGUUGUUCUAUCAAGUAGAUACCUCAUUGAUAUGAUGCUUUGGCCGUGGCUCCUGAGUCACCAAGGUGCAAGGUAGAAAUGCCCGCAUCUCCCGUACUUGGAAGGUGUUAUAGUGGAACAACU
RS 2 dot ………………(((…(((((…((((.((…((((…..))))…)).))))..)))))…))).(((((.(((((((.((..((((((..((((….)))).))))))…))))))…))).)))))(((……)))
RS 3 seq AAUGGAUAUUAACUCCUAGCCUCUGUGUCUAAGUCGUUGUUCUAUCAAAUGGAUACCACAUUGAUAUGAUGCUCUGGCCGUGACUCCUGAGUCACCAGGGUGCAAGGUAGAAAUACCUGCAUCUCCCGUACUUGGAAGGUGUUAUUAUGGAACAACU
RS 3 dot …(((…….)))..(((…(((((…((((.(((..((((…..))))..))).))))..)))))…))).(((((.(((((((.((..((((((.(((((….)))))))))))…))))))…))).)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table