Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082391 Similarity: 0.986 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA082391
Gene: POLR2B
MFE: -16.098
ENS: 0.994
Length: 68.
Predicted Ligands:
fluoride - 11/20
cobalamin - 8/20
glycine - 1/20
 RS: URS0000C2C4EE_1609134
MFE: -33.884
Ligand: cobalamin
Species: Streptomyces sp. NRRL S-444 Cobalamin riboswitch
 RS: URS0000D93EA5_1218103
MFE: -9.502
Ligand: fluoride
Species: Chryseobacterium indologenes NBRC 14944 Fluoride riboswitch
 RS: URS0000C038C5_676599
MFE: -20.312
Ligand: fluoride
Species: Stenotrophomonas panacihumi Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082391 URS0000C2C4EE_1609134 URS0000D93EA5_1218103 URS0000C038C5_676599
Length 68. 67. 68. 68.
Similarity - 0.986 0.984 0.983
Ensemble Norm 0.994 - - -
MFE -16.098 -33.884 -9.502 -20.312
Ligands - cobalamin fluoride fluoride
Gene POLR2B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6.001 2.
Length SE - 1. 0. 0.
Lev Distance - 16. 19. 22.
UBS 6. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 2. 1. 1. 1.
H 2. 2. 2. 2.
BL 2. 1. 1. 2.
BR 1. 0. 3. 2.
UN 0.088 0.104 0.118 0.103

Sequences

Field Description
UTR seq + 25 cuuuugauuucaagaguuaggagcucgagaaccguuuggcaauATGCTGGATTGTAATCAGCCACGAT
UTR dot + 25 ((((((….))))))…(..(((.((..((.((((((((…)))))))).))..)))))..)…
RS 1 seq GCCGGUGUGAUUCCGGCGCUGACCCGCAACCGUGACCCGCCCAGGCCCCGCCGGGCGGGAAGCCGGA
RS 1 dot (((((…….)))))……(((…..((..(((((((.(((…))))))))))..))))).
RS 2 seq GUACCAAAAGGAAAUGGUGUUCUUCCUUACCCAACCGCUUUACAGAAGCUGAUGACGCCUGAUUGAGA
RS 2 dot .(((((……..)))))……((((..((…((.((((((…))).))).)).))..)))).
RS 3 seq CCGCGCACAGGAGAUGGCAUUCCUCCUCGAACCGCCCGCACGCGUGGGCUGAUGAUGCCUGCCAAGCC
RS 3 dot ((…….))…(((((..(.((.(((….((((((….))))))))).)).)..)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table