Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082403 Similarity: 0.932 Similarity: 0.931 Similarity: 0.929
UTR: 5HSAA082403
Gene: POLR2C
MFE: -70.911
ENS: 0.780
Length: 218.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231C5BC_765914
MFE: -65.926
Ligand: cobalamin
Species: Thiorhodospira sibirica ATCC 700588 Cobalamin riboswitch
 RS: URS00023250F6_1349421
MFE: -58.118
Ligand: cobalamin
Species: Flavihumibacter solisilvae Cobalamin riboswitch
 RS: URS0000B72D2D_1183428
MFE: -91.793
Ligand: cobalamin
Species: Agrobacterium genomosp. 13 str. CFBP 6927 Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082403 URS000231C5BC_765914 URS00023250F6_1349421 URS0000B72D2D_1183428
Length 218. 219. 218. 218.
Similarity - 0.932 0.931 0.929
Ensemble Norm 0.780 - - -
MFE -70.911 -65.926 -58.118 -91.793
Ligands - cobalamin cobalamin cobalamin
Gene POLR2C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.005 10.004 20.
Length SE - 1. 0. 0.
Lev Distance - 85. 88. 85.
UBS 12. 10. 11. 12.
BS 5. 6. 3. 3.
ILL 1. 2. 2. 4.
ILR 2. 3. 1. 4.
H 4. 3. 5. 5.
BL 4. 3. 3. 5.
BR 5. 4. 4. 4.
UN 0.119 0.187 0.183 0.106

Sequences

Field Description
UTR seq + 25 cugugaagcagggagcccccugcauuaaauucaccugggcagggaggugagguguggugugugugggucuuauuaaaaugcaaguaccugggccccacucuaaugcuguggaaucagcccagcaaucugcaguuuagugucaggugauuccuaaaucuugagaaccacugcauuaagucuguagguaaauuugATGCCGTACGCCAACCAGCCTACCG
UTR dot + 25 ..(((((((((((….))))))……)))))…((.(((..(((..(((((((((((((.((((((((((……..))))…)))))))))…..(((((.((……)))))))((((((((((((((((..((((.((((……..).))).)))))))))))).))))))))…….)))))..))))).)))..))).)).
RS 1 seq GUAUUAUCCGCCCCUGACGGUUCCCCUUCGUGGGAUCAAAAGGGAACACGGUGUGUUGGUGUUGUAAAAAGCCAGCACGCAAACCGUGGCUGCCCCCGCAACUGUAAGCGAUGAGCCGGUACUCACGAUAUGCCACUGGUCGAUGUGACUGACUGGGAAGGCGGAGUACACAGGCGAUGACACGCAAGCCAGGAGACCUGCCGUCAACUGCGUCACCUA
RS 1 dot ……..(((…((((((((((.(((((((..(((….(((..((((((((((((((.((….)).))))))))….))))))…..)))(((……..)))….((((((((((……((((.(((((((…….)))))))…)))))))))).).))))))..)))).)))…)))…..)))))))…)))…….
RS 2 seq UACCUUCGCAGCGCGCCCGGUUCAGGUGAAUAAUAUGUUCACCAGAUUAAAAGGGAAGUCCGGUGCAAUUCCGGCGCUAUCCCCGUAGCUGUAAGUUUUUGUCAAUAGUAGUUUAUCUGCAUUGACCUGUUCAAUCUUCACACCACUGCCGGAUCAAACGGCGGGAAGGUAUUCAACAGCAAACAAGCCAGAAGACCUGCCAGGCCAUAACAUUCAUU
RS 2 dot …(((.((((((((……((.((((((((…)))))))).))……(((((((((((…….)))).))).))))))).))))))))…..((((((.((((…..))))))))))(((((..((((((……((((((…….))))))))))))….)))))…….(((………….)))………….
RS 3 seq GAGAAAUGCGGGUGUCAUGGUUCUCCGGGCCUGAUUAUUUCAAUCCCGGAGCUAAGAGGGAAUCCGGUGCGCCGUUUUAUCGGCAAGACCGGAGCUGCCCCCGCAACUGUAAGCGGCGAGCCUUUGUCCAUCCACGUCACUGGGGUGAAAGCCCCGGGAAGACGGGCAAAGGCGACGACCCGUAAGCCAGGAGACCUGCCAGGACAAAAUAACGUCCA
RS 3 dot …….((((((.((.((((((((((((..(((…..)))..)))))))……(((..((((((..((((……))))…))))))….)))((((……..))))((.((((((((((.((….((.(((((((….))))))))).)).))))))))))..))…….))))).)).))))))..((((……..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table