Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082501 Similarity: 0.982 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA082501
Gene: POLR3D
MFE: -34.489
ENS: 0.855
Length: 85.
Predicted Ligands:
GMP - 7/20
cyclic-di-GMP - 5/20
cobalamin - 3/20
 RS: URS0000D91706_1927122
MFE: -37.885
Ligand: cyclic-di-GMP
Species: Coriobacteriaceae bacterium EMTCatB1 Cyclic di-GMP-II riboswitch
 RS: URS0000C6B26E_1736483
MFE: -26.980
Ligand: zmp-ztp
Species: Microbacterium sp. Root180 ZMP/ZTP riboswitch
 RS: URS0000C1771F_1139996
MFE: -16.208
Ligand: SAM
Species: Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082501 URS0000D91706_1927122 URS0000C6B26E_1736483 URS0000C1771F_1139996
Length 85. 85. 85. 85.
Similarity - 0.982 0.979 0.978
Ensemble Norm 0.855 - - -
MFE -34.489 -37.885 -26.980 -16.208
Ligands - cyclic-di-GMP zmp-ztp SAM
Gene POLR3D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 12.001 3.003
Length SE - 0. 0. 0.
Lev Distance - 21. 24. 28.
UBS 8. 9. 9. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 2. 0. 2.
H 2. 2. 2. 2.
BL 3. 5. 6. 3.
BR 4. 5. 5. 3.
UN 0.024 0.047 0.047 0.082

Sequences

Field Description
UTR seq + 25 cggcuggucgcguugcaggugagguugugacgcgcgguguggagccgcggcccgggcaacATGTCGGAAGGAAACGCCGCCGGCG
UTR dot + 25 (.(((.(.((((((((((……))))))))))).).)).).((((((((((((……..))))……..))))).))).
RS 1 seq UGCGGUUCGGAGGCGAUGACUCGCUGCCCGUGACGUGGGCGCCUUGGGCGGCGACGAGCCAGUGGCGCAACCGGCCGAGAGCGCG
RS 1 dot .(((.(.(((.(((((….)))))..))).).)))..(((((((((.(((….(.(((…))).)..))).))))).)))).
RS 2 seq UCGGGGUGUCGCGACUGGCGUUGAGGUGGGUCACCACCGGGAAGCGACGGACUACGGCAUUCGACCGCACGCCUGGGCCGAUGUG
RS 2 dot ((((((((.(.(.(((……..))).)).)))).))))…(((.(((.(((.(((…………)))))).))).))).
RS 3 seq GACCGUUGCAAGUUCCCGAAAGGAUUCAUUUGUGUAGCAAAUGAAGAUGCCUUGUAACCGACAAAUAUUAGGGGGAAUCAUCAUG
RS 3 dot ….((((((((((((…..)))…)))..))))))..((((.(((.((((.(((……….))).)))).))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table