Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082757 Similarity: 0.977 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA082757
Gene: POP4
MFE: -25.957
ENS: 0.937
Length: 100.
Predicted Ligands:
TPP - 9/20
purine - 7/20
guanidine - 1/20
 RS: URS0000C497A5_698758
MFE: -16.403
Ligand: purine
Species: Amphibacillus xylanus NBRC 15112 Purine riboswitch
 RS: URS0000DB5365_1120975
MFE: -17.610
Ligand: TPP
Species: Alkalibacter saccharofermentans DSM 14828 TPP riboswitch (THI element)
 RS: URS0000C72DC7_1450761
MFE: -27.903
Ligand: TPP
Species: Aneurinibacillus sp. XH2 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082757 URS0000C497A5_698758 URS0000DB5365_1120975 URS0000C72DC7_1450761
Length 100. 100. 101. 101.
Similarity - 0.977 0.977 0.977
Ensemble Norm 0.937 - - -
MFE -25.957 -16.403 -17.610 -27.903
Ligands - purine TPP TPP
Gene POP4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.017 4.002 13.001
Length SE - 0. 1. 1.
Lev Distance - 30. 28. 25.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 1. 1. 2. 3.
H 2. 2. 2. 2.
BL 5. 4. 5. 3.
BR 4. 3. 5. 2.
UN 0.120 0.250 0.079 0.149

Sequences

Field Description
UTR seq + 25 gaagaguaagcggggccgcgaaguuggagaggguuggggacguuaagggucggggucuugguacuggugggugaaATGAAGAGTGTGATCTACCATGCAT
UTR dot + 25 ……….(((((((.(((…….((.(……..).))…..))).)))))))(((.((((((((.(.((…..)).).)))))))))))..
RS 1 seq GAAAAACAUAAAUAAGGUACAUGUAUAGGCUUAUGAAUUGGCGUAAGCGUUUCUACCAAAUGACCGUAAUCAUUGGACUACAUGUGAACGUUAGAGGGGU
RS 1 dot ……………((((.((((.((.(((……..))).)).))))…))))…(((.(((..((((((…..)).))))))))))…….
RS 2 seq GAAAUGUGCUGGGGGUGCCUAAAAGGCUGAGAAAAGUUGAACUUUAACCCUUUGAACCUGAUGCGGUUAAAACUGCCGGAGGAAAGCUUUAAUGGACGUUC
RS 2 dot …..((.(.((((((((((…))))……………….)))))).).))..(((((.((((((.((.((…))..)).)))))).).)))).
RS 3 seq AACCGCCACUAGGGGAGCUCUUGGGCUGAGAGAAGCGCUUGCUUCGACCCUUAGAACCUGAUCCGGAUAAUGCCGGCGGAGGGAAGUGGACGGGUGAUGCC
RS 3 dot ……..((((((((((….(.(((……))).)..)))….))))))).(((((.((((…..(.((……)).)..)))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table