Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA082768 Similarity: 0.982 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA082768
Gene: POP7
MFE: -24.326
ENS: 0.895
Length: 96.
Predicted Ligands:
TPP - 16/20
glycine - 2/20
tetrahydrofolate - 1/20
 RS: URS0000C47A57_171383
MFE: -22.629
Ligand: TPP
Species: Vibrio hepatarius TPP riboswitch (THI element)
 RS: URS0000AB4C10_887929
MFE: -30.562
Ligand: TPP
Species: Pseudoramibacter alactolyticus ATCC 23263 TPP riboswitch (THI element)
 RS: URS0000E26D6B_546
MFE: -31.099
Ligand: TPP
Species: Citrobacter freundii TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA082768 URS0000C47A57_171383 URS0000AB4C10_887929 URS0000E26D6B_546
Length 96. 98. 98. 96.
Similarity - 0.982 0.980 0.979
Ensemble Norm 0.895 - - -
MFE -24.326 -22.629 -30.562 -31.099
Ligands - TPP TPP TPP
Gene POP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.002 7.003
Length SE - 4. 4. 0.
Lev Distance - 19. 21. 25.
UBS 8. 8. 7. 7.
BS 0. 0. 1. 0.
ILL 4. 4. 4. 3.
ILR 4. 5. 4. 3.
H 2. 2. 2. 2.
BL 2. 1. 2. 2.
BR 2. 1. 1. 0.
UN 0.156 0.173 0.112 0.104

Sequences

Field Description
UTR seq + 25 aguuugagggcgacgcgaugaaugaaucggaacgggggguggggagacgcgggaucuggagggcacacagcATGGCAGAAAACCGAGAGCCCCGCG
UTR dot + 25 ……….((…((((……))))…))….((((((…(.(((..((((..(.((…..)).)..))))…))).)..)))))).
RS 1 seq UGGAAAUAGUCGGGGAGCCGAAAGGCUGAGAUCGCAUAGCGAGACCCGUAGAACCUGAUUCAGUUAGCACUGGCGUAGGGAACUAUUAGCGUCGCACC
RS 1 dot ………..(.((((((….))))….)).)…((((..(..((((..((((..(((((….)))))..))))…))))..)..))))…
RS 2 seq UAAAUAUCACAGGGGAGCUCUUGCUGAGAAAGGCACAUGCCUGACCCUCAUGACCUGAUCCGGACAAUGCCGGCGCGGGGAGUGAAGCACAGCCCCUC
RS 2 dot ……….(((((.((…((((……))))…))(((..(.((((..((((..((((……))))..))))..)))).)..)))))))).
RS 3 seq UUCAACGACUCGGGGUGCCCUUCCUGGUGAAGGCUGAGAAAUACCCGUACCACCUGAUCUGGAUAAUGCCAGCGUAGGGGGCCGAAAUUCGGCCUA
RS 3 dot …….((.(((((……)))))))..((((((((…….((..((.((((..((((……))))..))))))..))…)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table