Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083047 Similarity: 0.961 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA083047
Gene: PPARG
MFE: -18.126
ENS: 0.924
Length: 142.
Predicted Ligands:
cobalamin - 10/20
glucosamine - 8/20
SAM - 1/20
 RS: URS0002313627_755732
MFE: -24.619
Ligand: cobalamin
Species: Fluviicola taffensis DSM 16823 Cobalamin riboswitch
 RS: URS00023171B0_1712028
MFE: -31.983
Ligand: cobalamin
Species: Psychrobacillus sp. FJAT-21963 Cobalamin riboswitch
 RS: URS0000AB7684_313596
MFE: -44.138
Ligand: SAM
Species: Robiginitalea biformata HTCC2501 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083047 URS0002313627_755732 URS00023171B0_1712028 URS0000AB7684_313596
Length 142. 142. 140. 144.
Similarity - 0.961 0.961 0.960
Ensemble Norm 0.924 - - -
MFE -18.126 -24.619 -31.983 -44.138
Ligands - cobalamin cobalamin SAM
Gene PPARG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.005 10.004 13.023
Length SE - 0. 4. 4.
Lev Distance - 48. 44. 45.
UBS 4. 7. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 2.
ILR 0. 1. 1. 2.
H 4. 5. 4. 2.
BL 0. 1. 2. 0.
BR 0. 1. 1. 0.
UN 0.303 0.232 0.364 0.153

Sequences

Field Description
UTR seq + 25 agcaagaaggagaugacauauacuuaaguuucaguagaaagauuugaaagaagccaacacuaaaccacaaauauacaacaaggccauuuucucaaacgagagucagccuuuaacgaaATGACCATGGTTGACACAGAGATGC
UTR dot + 25 …………………..((((((((……..))))))))…..(((……………………..)))…..((((….))))(((((((……………..)))))))……….
RS 1 seq UGUUCAAUAUCCAGAAAAGGUUUUUCGUUUAGGCGAAAAUAAAAGGGAAACGUGUUAAAAUCACGUGCUGUCGCGCAACUGUAAUUCCAACUCAUCGAGAAGUUGGAAAAGCCAGGUUACUUUCCAUUUCUGAUUCGCUCAC
RS 1 dot ……………….(((((((.((((……..)))).)))))))(((…….)))((((….))))….((..((((((((……..))))))))..))((((…………))))……….
RS 2 seq GAAUAUUUUGAACAUAAAGGUGCUUGCUAGUUUACUAGUAAGUUAAAAGGGAAGCUGGUGCAAGUCCAGCGCGGUCCCGCCACUGUAAGUGAUUGUACAUGAUCACAAGUCAGAAAACCUGCCUUUAUGCGUUUACACUU
RS 2 dot …………………(((((((((….)))))))))…..((((.(((((…….)))))….))))……….((((((……))))))(((.(((…..))).)))……………
RS 3 seq GCGUUAUCAAGAAAGGUGGAGGGAAUAGACCCGGUGAAACCUUAGCAACCCUUUACCCCUGUCCGGGGCAAAAGAAGGUGCUACAUUCUAUCCUGCAGCCCGGUGGCUACCCGCACCGGAAACCGCUGCCCGGACAGAUAACCA
RS 3 dot …………..(((((((((………(((…)))…….))))))))).((((((((……………………….(((((((((((……..))))))…..)))))))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table