Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083103 Similarity: 0.967 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA083103
Gene: PPFIA1
MFE: -49.407
ENS: 0.939
Length: 125.
Predicted Ligands:
TPP - 9/20
cobalamin - 4/20
molybdenum - 2/20
 RS: URS0000D7E90A_1797834
MFE: -36.989
Ligand: molybdenum
Species: Deltaproteobacteria bacterium RBG_13_61_14 Moco (molybdenum cofactor) riboswitch
 RS: URS00023279F6_1226750
MFE: -44.533
Ligand: cobalamin
Species: Mycobacterium phlei DSM 43239 = CCUG 21000 Cobalamin riboswitch
 RS: URS00007795F2_1354304
MFE: -29.954
Ligand: TPP
Species: Xenorhabdus poinarii G6 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083103 URS0000D7E90A_1797834 URS00023279F6_1226750 URS00007795F2_1354304
Length 125. 125. 127. 126.
Similarity - 0.967 0.967 0.967
Ensemble Norm 0.939 - - -
MFE -49.407 -36.989 -44.533 -29.954
Ligands - molybdenum cobalamin TPP
Gene PPFIA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 7. 7.008
Length SE - 0. 4. 1.
Lev Distance - 41. 36. 40.
UBS 12. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 3. 3. 2. 3.
H 3. 3. 3. 3.
BL 3. 4. 5. 4.
BR 5. 3. 4. 4.
UN 0.056 0.080 0.063 0.143

Sequences

Field Description
UTR seq + 25 ucaacgguccucaccccccgggguucggggcuuccgccgcaccugauacaggaggggaggagugcggcucgagcaggcuggaggucaccauccccaucagATGATGTGCGAGGTGATGCCGACCA
UTR dot + 25 ….((.(((((.(((.((..(..(((((((…….)).)))))..).)).)))))))).))(((((……)))))..((((..((((((((((….))))…..)).))))..)))).
RS 1 seq GGAUAUUUUUGUCUCCGAGUUACUGCUUCCUAAAGCCGGAAUCGAGGCCAUGGACAGUGACCGCUAGGCCUGGAAGGAAACUUCCUGACCCCCCGUGUUUGGAAAGGAGACGGCAGCAAGAGGGU
RS 1 dot ……….((((.((.(((((((..(((….(((……..)))…))))))))))))..))))(.(((((….))))).)(((((((((.(((…..))).))))……).))))
RS 2 seq GGUACCUGACGCACCGGCGGGACCCAUUGCUUAGGAUGAGCGGGUAAUCGGCGGGCGAAGGAAUCUGGUGAGAAUCCAGAACGGUCGCGCCACUGUGUCAAGUCAGACCCGACGUCCGUCGCCGUUU
RS 2 dot ….(((..(((.(((.(((.((((…(((((…)))))))))..))).)))))).)))…((((…….))))((((((.(((….((.(((……))).))…..))).)))))).
RS 3 seq UUUUUCUUGUCGGAGUGCCUAACGUUCACCGUCUUAUCACGAUGAACACAGGCUGAGACCGUUAAUUCGGGAUCCGCAGAACCUGAUCGGGCUAGUACCCGCGAAGGGAACAAGAGUAAUCACCCC
RS 3 dot ……….(((…((((…(((((.(((……))).)))))..))))…..)))…..(((((.((….)).)))))..(((((.((.(((…..))).)).))……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table