Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083267 Similarity: 0.959 Similarity: 0.958 Similarity: 0.956
UTR: 5HSAA083267
Gene: PPHLN1
MFE: -40.381
ENS: 0.959
Length: 152.
Predicted Ligands:
cobalamin - 10/20
FMN - 6/20
TPP - 3/20
 RS: URS0000AB1DB1_401473
MFE: -44.107
Ligand: FMN
Species: Bifidobacterium dentium Bd1 FMN riboswitch (RFN element)
 RS: URS0000AB5F75_367928
MFE: -39.292
Ligand: FMN
Species: Bifidobacterium adolescentis ATCC 15703 FMN riboswitch (RFN element)
 RS: URS0000DAF9A2_1027249
MFE: -32.818
Ligand: FMN
Species: Gracilibacillus sp. K170 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083267 URS0000AB1DB1_401473 URS0000AB5F75_367928 URS0000DAF9A2_1027249
Length 152. 153. 153. 153.
Similarity - 0.959 0.958 0.956
Ensemble Norm 0.959 - - -
MFE -40.381 -44.107 -39.292 -32.818
Ligands - FMN FMN FMN
Gene PPHLN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.011 2. 4.
Length SE - 1. 1. 1.
Lev Distance - 49. 54. 56.
UBS 10. 12. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 4. 5. 4. 4.
H 4. 4. 4. 3.
BL 2. 4. 2. 1.
BR 0. 2. 1. 0.
UN 0.197 0.092 0.209 0.209

Sequences

Field Description
UTR seq + 25 auugcgcgcgccggaaguaccuaccugggauaacggcggcgagcggacggcugcauuuacggggucucccggagggccagagucggaaauuguugaaaacguuaaauuugauuccuaaaaggacucaATGGCTTACAGAAGAGACGAAATGT
UTR dot + 25 ….(((.(((((…((.(((….)))))..)))))))).((((….))))…..((((….))))..(((((((((((((((…(((……….)))….))))……)))))..))))))………………
RS 1 seq CACAAGUUUCAGGGAAGGUGAAAACCCUUACUGGCGGUAACGGUGAAACCGAUGACCAUAACGGCCCACCACCGAAGCCCGCGACCCGCGAAUGCGGCUGAUCCGGUGAGAAUCCGGGGCCAACGGUCAAAGUCCGGAUGGAAGAAACGGAGC
RS 1 dot ……..((((.((.(((….))).)).))))((((………)))).(((((…..(((((.((((((.((((((((…))))…..))))….)))))…….))))))…)))))…((((..(…..)..))))..
RS 2 seq AGCAAGUUUCAGGGAAGGUGAAAAUCCUUACUGGCGGUAACGGCACGACCGGCAUUCAUAACGGCCCCAUACCGAAGCCCGCGACCCGCGAAAGCGGCUGAUCCGGUGAGAAUCCGGGGCCAACGGUUACAGUCCGGAUGGAAGAAACGGAGC
RS 2 dot ……..((((..((((…….)))).))))((((………))))………..((((((.(((((.((((((((…))))…..))))….)))))…….))))))………..((((..(…..)..))))..
RS 3 seq AUAUUCCUUUGGGGCAGGGUGUAAUUCCCGACCGACGGUGAUAAAAGCAUAGUAGCUUUUUUAGUCCGUGACCCGGAUCAUUUGUUAAAUGUGAAGGUGGAUUUGGUGUGAAUCCAAAGCCGACAGUGAAAGUCUGGAUGGGAAAAGGAAUUG
RS 3 dot …………((..(((…….)))..)).((((….((((((……))))))…..))))…((((((((.(((((………(((((((((…..))))))…)))))))))))…)))))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table