Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083309-0 Similarity: 0.959 Similarity: 0.955 Similarity: 0.954
UTR: 5HSAA083309-0
Gene: PPIA_0
MFE: -63.792
ENS: 0.984
Length: 174.
Predicted Ligands:
cobalamin - 7/20
Mg2+ - 6/20
TPP - 4/20
 RS: URS0002312886_443254
MFE: -56.866
Ligand: cobalamin
Species: Marinitoga piezophila KA3 Cobalamin riboswitch
 RS: URS0002323741_1462524
MFE: -35.617
Ligand: cobalamin
Species: Paraliobacillus sp. PM-2 Cobalamin riboswitch
 RS: URS0000D81D44_1941208
MFE: -37.083
Ligand: Mg2+
Species: Entomoplasmatales bacterium EntAcro10 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083309-0 URS0002312886_443254 URS0002323741_1462524 URS0000D81D44_1941208
Length 174. 176. 175. 172.
Similarity - 0.959 0.955 0.954
Ensemble Norm 0.984 - - -
MFE -63.792 -56.866 -35.617 -37.083
Ligands - cobalamin cobalamin Mg2+
Gene PPIA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 10.001 10.001
Length SE - 4. 1. 4.
Lev Distance - 48. 54. 51.
UBS 13. 13. 11. 14.
BS 0. 0. 0. 0.
ILL 5. 5. 6. 5.
ILR 5. 6. 6. 7.
H 1. 1. 1. 1.
BL 3. 4. 3. 4.
BR 4. 4. 2. 6.
UN 0.046 0.062 0.080 0.023

Sequences

Field Description
UTR seq + 25 acucuggcgaagucgcagacccgauuggccgggacggaggcgcgagaccggguugcgggcggggccgaacgugguauaaaaggggcgggaggccaggcucgugccguuuugcagacgccaccgccgaggaaaaccguguacuauuagccATGTGTCAGGGTGGTGACTTCACAC
UTR dot + 25 ……(.((((((((..((((((((((((((..(((.((((((((((..((.(((((((..((((…(((…………)))…))))..))))))))))))))))….))).))))))………………..))))…))).)))).)))))))).)..
RS 1 seq AAAUAAAAAUUCCUUUAAAGUGUAAGGGAAAGCGGUGAAAAUCCGCUGCGGGCGCGCCACCGUGAGUGGGGACGAAACUGGCAAAGUAACGCCACUGGAAUUGUUUAUAUUCCGGGAAGGCGCCAGGAGUAGGAAGAUCCACAAGCCGGGAGACCUGCUUUAAAGGGAUUUGUUCC
RS 1 dot ……(((((((((((((((…(((…..((((((…((((((.(.(((((….(((.(((((.((((((..(((((……..))))…)..)))))).))))))))….))))).).))).)))…))…..))))…..))))))))))))))))))…..
RS 2 seq AAUUUAAACGGUGUGGUUGGUGACUAUAACAGGGAAUCUGGUGAAAAUCCAGAACUGUCCUCGCAACUGUAAAUACAAACGAACGGAACAUGACCACUGUAUCAAUAGGAUAUGGGAAGGGUUCCUAGUAGAUCAAUGUAUAAGUCAGUAGACCUACCAACACAUCGUAAUGUAU
RS 2 dot …….(((((((.((((((((((…(((..(.(((((.((..(((((…….((((…..((((..(((((………………..)))))..))))…..)))).)))))..)).))))))..)))…))))………)))))))))))))…….
RS 3 seq GUUUUAUUCUGUUAGGUGAGGCUACUUUAUGAAUAUAUGCUGCUACCCACUUUUGUCUAAAGACAAAAAAUGGGUGAACAACUUUUGUCGAAUUAAGGCUUAAGUUAAUGUAGCUGACUUAUAUUUUAAGUCAAAGUUGUAAAGUGCUAAAGCUCAACGUGGUGAAUAAAUU
RS 3 dot ..(((((((..(((.((..((((((((((((((((((.((.(((((..((((..((((((.(((((((..((……))..)))))))…))).)))..))))….))))).).).)))))))…………)))))))…..))))..)).))).)))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table