Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083309-1 Similarity: 0.951 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA083309-1
Gene: PPIA_1
MFE: -31.933
ENS: 0.897
Length: 174.
Predicted Ligands:
lysine - 17/20
cobalamin - 3/20

 RS: URS0002331AB6_1797313
MFE: -34.348
Ligand: cobalamin
Species: Bacteroidetes bacterium GWA2_30_7 Cobalamin riboswitch
 RS: URS0000C550BE_999411
MFE: -41.529
Ligand: lysine
Species: Clostridium colicanis 209318 Lysine riboswitch
 RS: URS0000AB32F9_768706
MFE: -45.023
Ligand: lysine
Species: Desulfosporosinus orientis DSM 765 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083309-1 URS0002331AB6_1797313 URS0000C550BE_999411 URS0000AB32F9_768706
Length 174. 174. 174. 175.
Similarity - 0.951 0.951 0.951
Ensemble Norm 0.897 - - -
MFE -31.933 -34.348 -41.529 -45.023
Ligands - cobalamin lysine lysine
Gene PPIA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.017 6.003 5.
Length SE - 0. 0. 1.
Lev Distance - 62. 64. 63.
UBS 9. 8. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 2. 3. 3. 3.
H 4. 3. 4. 5.
BL 3. 1. 1. 2.
BR 2. 1. 2. 1.
UN 0.115 0.247 0.172 0.120

Sequences

Field Description
UTR seq + 25 caucugugaaauagcuuauaaaaugcuacuuuuaaacaagcuguuuuuaugaaagggcuuguaaauguuuaugguauuuaagcuaccucucuagccauaacguauuauacauucaagaaagguucaaaaccagauauacuagaaaccaaATGTGTCAGGGTGGTGACTTCACAC
UTR dot + 25 ………..(((((((…(((((((…….(((((((.((((…)))).)))))))………))))))))))))))(((.(((…………………..))).)))……(((.((((((…………))))))..))).(((….)))..
RS 1 seq UAAAUUUGCACUUGAAUUGGUUCUUAUAGAUUAAAAGGGAAUCGGGUGAAAAUCCUGAACAGUUCCCGCUGCUGUAAGCUCCGUAACUCUUUUUAAAUCAAUAGCCACUGUCGAGUAUGGGAAGGCAAAAAAGAGGGAGCAAGUCAGAAGACCUGCNNNNNNNAAAACAAACAU
RS 1 dot ………………((..(((((((…….((((((((((…….)))))….)))))….)))))))..))….((((((((…………..((((………..))))))))))))…(((.(((….))).)))………………
RS 2 seq CGAAGAGGUAGAGGCGCGAAUCUUAAGAGUACUAUAGUUUUUAUAAGCAAAUUGGAACUAUAGGAAAGGAAGAUUCGCCGAAGGAUAUAAGAAAUUGCUUUAAUCUUAUAAUCCUGGGGUUAUGCAGAAUAUGCAUAAGACUGUCACAAGAAAUUGUGUUGGGCUAUCAUUCUA
RS 2 dot …………….((((((((…….((((((((((.((……)).))))))))))……))))))))((..(((((((((((………..))))))).))))..))(((((((…..)))))))..((..(((((….)))))..))…………
RS 3 seq AUUUUAGAUAGAGGUGCAGUUAUUAAGAGUAAACACACUGAGCUAUCCGGCUAUGAUGUGUGCCGAAAGGAAUAAUUGCCGAAGUAAAAGGCUGUGGUAUAAGGACUUUUACUGGUUAUGUAUUUAAUAGGUACAUGACUGUCACCUAGACGCUGGGUGGAGCACUAUCUCUUAA
RS 3 dot ………….(.(((((((((……..((((((..((((….))))..).)))))………))))))))))..((((((((.((……..))..))))))))((((((((((((…))))))))))))..(((((((…)))))))(((……)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table