Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083315 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA083315
Gene: PPIA_2
MFE: -14.839
ENS: 0.987
Length: 65.
Predicted Ligands:
fluoride - 18/20
cobalamin - 1/20
SAM - 1/20
 RS: URS0000C6F3F3_1300914
MFE: -9.837
Ligand: fluoride
Species: Mucilaginibacter sp. PAMC 26640 Fluoride riboswitch
 RS: URS0000BE5E99_12908
MFE: -14.635
Ligand: fluoride
Species: unclassified sequences Fluoride riboswitch
 RS: URS0000D9BDC4_1882406
MFE: -14.359
Ligand: fluoride
Species: Alicyclobacillus sp. USBA-503 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083315 URS0000C6F3F3_1300914 URS0000BE5E99_12908 URS0000D9BDC4_1882406
Length 65. 65. 65. 64.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.987 - - -
MFE -14.839 -9.837 -14.635 -14.359
Ligands - fluoride fluoride fluoride
Gene PPIA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6. 9.025
Length SE - 0. 0. 1.
Lev Distance - 16. 16. 14.
UBS 5. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 1. 2. 1. 0.
H 2. 1. 2. 1.
BL 0. 1. 2. 2.
BR 1. 1. 2. 2.
UN 0.215 0. 0.231 0.375

Sequences

Field Description
UTR seq + 25 guuuugcagacgccaccgccgaggaaaaccguguacuauuATGTGTCAGGGTGGTGACTTCACAC
UTR dot + 25 …..((….))(((((((..(….((((((……)))).)))..)))))))………
RS 1 seq UAAAAACAAGGCAAUGGUGUUCUGCCUAUUUGAACCGCUGCAAAGCUGAUGACGCCUACCCAAAU
RS 1 dot ………((….(((((((.((…((((……..)))))).))..)))))…))….
RS 2 seq AACCCCAAGGGAAAUGGUGUCUUCCCUGCACAAACCGCUUGAAAGCUGAUGACGCCUUCAAAUCG
RS 2 dot ..(((…)))….((((((.((…((.(((…..)))…)).)).))))))………
RS 3 seq AGUGAUAUCGGUGAUGGAGCUCACCAGAAAGCCUCUACAAGAGGAUGAUGGCUCCUGCAAAAGC
RS 3 dot ……………(((((.((.((…..(((((…))))).)).)))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table