Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083329 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA083329
Gene: PPIC
MFE: -17.196
ENS: 0.959
Length: 101.
Predicted Ligands:
SAM - 9/20
glycine - 4/20
TPP - 3/20
 RS: URS0000D6B287_12908
MFE: -34.590
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000DA6568_1797612
MFE: -30.942
Ligand: SAM
Species: Chloroflexi bacterium GWB2_49_20 SAM riboswitch (S box leader)
 RS: URS0000C1ACC5_484770
MFE: -17.244
Ligand: purine
Species: Pelosinus sp. UFO1 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083329 URS0000D6B287_12908 URS0000DA6568_1797612 URS0000C1ACC5_484770
Length 101. 100. 102. 101.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.959 - - -
MFE -17.196 -34.590 -30.942 -17.244
Ligands - Ni/Co SAM purine
Gene PPIC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.010 6. 9.004
Length SE - 1. 1. 0.
Lev Distance - 29. 29. 30.
UBS 7. 6. 7. 8.
BS 0. 0. 1. 0.
ILL 2. 1. 0. 1.
ILR 2. 1. 2. 4.
H 4. 4. 3. 3.
BL 1. 1. 1. 2.
BR 1. 1. 1. 0.
UN 0.040 0.140 0.059 0.099

Sequences

Field Description
UTR seq + 25 uauucaacugaaguaaucucuuuagaaaggauauggauauaaaggaagcaaguuucaucgugucaucaaggauuucATGGGCCCGGGTCCTCGGCTGCTGC
UTR dot + 25 (((((..((((((……))))))…)))))..(((((…((((…..))))…)))))..(.(((((((………))))))).)((….))
RS 1 seq GCAGGAAAAGCUGAGCAGGCAGUAUCUCCUGCUGAUGGUAGAUAUGGAGCCGGGCCGUGAAAACGGCAGCAGAAGCAUGAAGCGCAUCUGCGGGACAGUA
RS 1 dot ((((((…((((……))))…))))))…((((………)))).(((((….))))).(((((.((…….)).)))))………
RS 2 seq CUCUUAUCCAGAGAGGUGGAGGGACCGGCCCUUUGAAACCUCGGCAACCUGAUUAAAUUCAAGGUGCCAAUUCCGGCAGAUAUAUGUUCUGGAAGAUGAGAG
RS 2 dot ((((((((….(((((((((((…..))))))…)))))(((.((((((……))).))))))..((((((((……))..))))))))))))))
RS 3 seq UAAACCUCAUGUUAAUAGUCUCGUAUAAUUUUGGGGAUAUGGCCCAGAAGUUUCUACCGGCAGCCGUAAAUUGCCUGUCUACGAGUGAAAGUGUAUCUAGG
RS 3 dot ….(((((.(((.(((……))))))..))))).(((((((((((….)))…))..))))))…..((((..((((……..))))..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table