Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083355 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA083355
Gene: PPIH
MFE: -36.141
ENS: 0.994
Length: 95.
Predicted Ligands:
TPP - 7/20
SAM - 5/20
glycine - 5/20
 RS: URS0000C544C8_1660119
MFE: -19.180
Ligand: TPP
Species: Niastella sp. SCN 39-18 TPP riboswitch (THI element)
 RS: URS0000C62438_12908
MFE: -18.518
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C33A37_1592897
MFE: -14.367
Ligand: TPP
Species: Coxiella-like endosymbiont TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083355 URS0000C544C8_1660119 URS0000C62438_12908 URS0000C33A37_1592897
Length 95. 97. 96. 96.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.994 - - -
MFE -36.141 -19.180 -18.518 -14.367
Ligands - TPP glutamine TPP
Gene PPIH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 2.018 15.002
Length SE - 4. 1. 1.
Lev Distance - 20. 26. 23.
UBS 5. 7. 5. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 0. 1. 0.
H 3. 3. 3. 3.
BL 1. 1. 2. 2.
BR 1. 3. 1. 4.
UN 0. 0.247 0.333 0.156

Sequences

Field Description
UTR seq + 25 gaaauccgcggaccgggcuuuagguucgccggaaucccacgcucccgacuucugcuuccgggucggagccATGATTGCTGGTGACAGTGATAGAA
UTR dot + 25 ….((((((((((……..))))))).)))…….(((.(((((((……..))))))))))….(((((((….)))))))….
RS 1 seq AGAUGUUGCCAGGGGUGUUCCAAACGGAUCUGAGAAUAUACCCAAAUCACUUGAUGCGGAUAAUGCCGACGUAAGAAAAUUGUGAAAAGCAAUAAUG
RS 1 dot ………..(((((((((((……..)).)))))).)))……(((.((((((……))).))))))…(((((…..)))))….
RS 2 seq AUCGUUCAUUCUCGCAACGAGAACGGAAGUAAGAAACCUGAAAACCUCUCACUUUCUGUGAGGCUAGUUAACCGAAAGUUUCCGAAGGAACGCAUG
RS 2 dot ….(((.((((((…)))))).)))……………(((.((((((…..))))))…)))……..(((((….)))))…..
RS 3 seq CAUUAUCUCUCGGGGAGCGAAAGCUGAGACGAUUUAAUUGGACCCGUUGAACCUGCACAAGAUAAUGCUUUCAAAGAAAAGAGAAAUACCUGUUUU
RS 3 dot ….(((((((((……….)))))).)))………..(.(((((…(((……..))).))))).)((((.((……)).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table