Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083495 Similarity: 0.967 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA083495
Gene: PPME1
MFE: -45.708
ENS: 0.792
Length: 124.
Predicted Ligands:
cobalamin - 8/20
FMN - 3/20
SAM - 3/20
 RS: URS0000DB2B03_399736
MFE: -42.450
Ligand: FMN
Species: Agrococcus jejuensis FMN riboswitch (RFN element)
 RS: URS0002320773_1125712
MFE: -57.938
Ligand: TPP
Species: Olsenella profusa F0195 TPP riboswitch (THI element)
 RS: URS0002311B46_134962
MFE: -48.537
Ligand: cobalamin
Species: Nocardia soli Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083495 URS0000DB2B03_399736 URS0002320773_1125712 URS0002311B46_134962
Length 124. 123. 124. 123.
Similarity - 0.967 0.963 0.963
Ensemble Norm 0.792 - - -
MFE -45.708 -42.450 -57.938 -48.537
Ligands - FMN TPP cobalamin
Gene PPME1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 24.015 15.
Length SE - 1. 0. 1.
Lev Distance - 40. 37. 41.
UBS 12. 12. 9. 11.
BS 0. 0. 0. 0.
ILL 2. 4. 0. 4.
ILR 1. 2. 1. 3.
H 2. 1. 3. 1.
BL 4. 4. 3. 5.
BR 7. 7. 4. 5.
UN 0.040 0. 0.161 0.057

Sequences

Field Description
UTR seq + 25 gggcgucguuaggggagcgagucgugaccgguugggccacacucaacgugggacgaagcuucgccuacuguuugacuacgugcgugcagccuccccucgATGTCGGCCCTCGAAAAGAGCATGC
UTR dot + 25 ((.((.((((((((((………….(((((.(((((..((((((((((.(((….)))))))).))).))….))).)).))))))))))).)))).)).))(((…..)))…..
RS 1 seq GAGUGCUCACGGGGUCAGUGCAAGUCUGAACCGGCGGUCAGAGUCCGCGAACCUCCCAUCCCGGGAGGCCGAGCAGGUGGAAUUCCUGCACCGACGGUGAGAGUCCGGAUGGAAGUGACACUC
RS 1 dot (((((.((((…(((.(.((…(((..((((.((((((((((((((…((((((…..))))))……..))))).))).)).)))).)))).))))).).)))….)))))))))
RS 2 seq GCAAACGGGGGGCUGGCGCACGCCGGCUGAGAUAUGGCCCAGCGCGGCCAUGACCCGUGGGUGGCGUGGCCACCCACAACCUGAUCUGGGUAAUGCCAGCGUAGGGACCUUGGCACGCGCGCCG
RS 2 dot ……….(((((((….)))))))…….(((((.((((((.(((.(((((((((((((…)))))))))……….)))).))))).)))).))).))..(((……))).
RS 3 seq GAAAGUUGCUGGGGGGAGGGGGUCAGUACGAUCGGGUUGCUCGGCGGGUGACGAGGAAACCGGUGGAAAUCCGGUGCGGUCGCGCCACUGUGAACAGCCAGACCCUCUCCGGCGAGCACCACC
RS 3 dot ….(.((((.(..((((((((………((.(((((.(((..(((((.(((….(((((…….)))))….))))))).)..))).))))).))))))))))..).)))).)…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table