Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083556 Similarity: 0.958 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA083556
Gene: PPP1CC
MFE: -75.182
ENS: 0.684
Length: 156.
Predicted Ligands:
Mg2+ - 13/20
cobalamin - 4/20
SAM - 2/20
 RS: URS0000C3EF81_1156417
MFE: -41.076
Ligand: Mg2+
Species: Caloranaerobacter azorensis H53214 M-box riboswitch (ykoK leader)
 RS: URS0000C06393_1588023
MFE: -54.615
Ligand: FMN
Species: Arthrobacter sp. Hiyo8 FMN riboswitch (RFN element)
 RS: URS000233426D_1262870
MFE: -49.489
Ligand: cobalamin
Species: Dialister sp. CAG:486 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083556 URS0000C3EF81_1156417 URS0000C06393_1588023 URS000233426D_1262870
Length 156. 157. 155. 157.
Similarity - 0.958 0.957 0.956
Ensemble Norm 0.684 - - -
MFE -75.182 -41.076 -54.615 -49.489
Ligands - Mg2+ FMN cobalamin
Gene PPP1CC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.005 17.002 3.
Length SE - 1. 1. 1.
Lev Distance - 54. 52. 57.
UBS 4. 3. 2. 4.
BS 10. 9. 10. 9.
ILL 0. 1. 0. 1.
ILR 0. 1. 0. 0.
H 2. 2. 2. 2.
BL 5. 4. 2. 5.
BR 5. 4. 3. 6.
UN 0.186 0.255 0.232 0.204

Sequences

Field Description
UTR seq + 25 gggggggacccgccgcggcugcugccaccgccgccaccaccgccucugcucguggcgugggaaaggaggugugagucccgggcgcgagccggcggcggcgccgcugcgggagggucggcggugggaaggcgATGGCGGATTTAGATAAACTCAACA
UTR dot + 25 (..(((((.((((((..(((..(.(((((((((((..(.((((….((((((.((.(((((………….))))).))))))))(((((….)))))..)))))..)).))))))))).).)))..)))))).))……..)))..).
RS 1 seq UAUGAACCUGGUUAGGAGAGGCUACUAUAUAGAAAUACGCCACUGCCCAGAAACAUCCAGAGAUGCCAAUGGGUAAACAGGUAUAAUCGAGAAGGUUAUAUCUAAUGUGGCUGGCCAAGGCCUAAGCUAUAUAGAGCUAAAACCCAACAGGUGAAAG
RS 1 dot …..((((.(((.((…((((.((((((((……(((..((.((((..(((((((..(….)..)))……((((((((((…..)))))))))).))))..)))).)).)))…..))))))))))))….)).)))))))…..
RS 2 seq AUACGUGCUCCGGGGUCGGUGUAAUUCCGAACCGGCGGUUAUAGUCCGCGACCCGCGAGCCAUCGCGUUUCCUUCACGGGAAUCACGGCGGCGGACGGUUGAACUGGUGGAAUUCCGGUACCGACAGUUAAAGUCUGGAUGGGAGAAGCACGUAC
RS 2 dot .((((((((((((((((((((…..((((((((.(((((((.((((((..(((((((….))))).(((((….)))))….))..)))))).))..))))).)))..))).)))))))))……..))))))……..))))))).
RS 3 seq UAAUUCGACAACUACAUAGGAAACAGGACAGGGGAAGCUGGUGAGAAUCCAGCACUGUUCCGCAACUGUAUGGGGAGCUCUCUCAUGGCAAGUCCGUCACGAGGACAUGAGAAGCGAGGAACUCAGUCAGAGUGCCUGCCUGUUUCUACUGCAGGAA
RS 3 dot ………..((.((..(((((((((.((((.(…((((((((..(((.((…(((((.((……)).)))))..((((((…..((((…….)))))))))).))..))).)))).))))..).)))))))))))))..)).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table