Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083630 Similarity: 0.990 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA083630
Gene: PPP1R3F
MFE: -4.121
ENS: 0.989
Length: 41.
Predicted Ligands:
SAM - 9/20
preQ_1 - 7/20
zmp-ztp - 2/20
RS: URS0000CBFF2B_2021
MFE: -13.547
Ligand: guanidine
Species: RNA (41-MER) from Thermobifida fusca (PDB 5NY8, chain B)
RS: URS0000C65269_1581037
MFE: -5.855
Ligand: preQ_1
Species: Bacillus sp. FJAT-22058 PreQ1 riboswitch
RS: URS00021EDBDC_12908
MFE: -10.217
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083630 URS0000CBFF2B_2021 URS0000C65269_1581037 URS00021EDBDC_12908
Length 41. 41. 43. 41.
Similarity - 0.990 0.986 0.986
Ensemble Norm 0.989 - - -
MFE -4.121 -13.547 -5.855 -10.217
Ligands - guanidine preQ_1 SAM
Gene PPP1R3F - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 5.008 8.002
Length SE - 0. 4. 0.
Lev Distance - 11. 13. 17.
UBS 4. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 1. 0. 1.
H 2. 2. 2. 2.
BL 2. 0. 0. 0.
BR 1. 0. 1. 0.
UN 0.049 0.024 0.140 0.

Sequences

Field Description
UTR seq + 25 cgccgccgccgccgauATGGATGATAACACCTTTGCCATGG
UTR dot + 25 ((.((….)).)).(((((.(((……..)))))))).
RS 1 seq CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC
RS 1 dot ((……)).(((((((..((…..))…..)))))))
RS 2 seq GCGGAAGAGGUUCUAGCUACCCUCUCAAAAAAACUAAGGAGAA
RS 2 dot ((((((….)))).))…..((((…………)))).
RS 3 seq CCUACAACGGCUUCCUGAAGUAGGUGUUUUUUUUUGGAGCA
RS 3 dot (((((..(((….)))..)))))((((((…..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table