Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA083892 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA083892
Gene: PPP2R5D
MFE: -43.479
ENS: 0.
Length: 111.
Predicted Ligands:
TPP - 7/20
SAM - 6/20
glycine - 3/20
 RS: URS0000AB6F51_380703
MFE: -32.167
Ligand: glycine
Species: Aeromonas hydrophila subsp. hydrophila ATCC 7966 Glycine riboswitch
 RS: URS0000C3FDEC_1235279
MFE: -33.689
Ligand: SAM
Species: Bhargavaea cecembensis DSE10 SAM riboswitch (S box leader)
 RS: URS0000ABB7A7_272631
MFE: -29.330
Ligand: TPP
Species: Mycobacterium leprae TN TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA083892 URS0000AB6F51_380703 URS0000C3FDEC_1235279 URS0000ABB7A7_272631
Length 111. 111. 111. 111.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0. - - -
MFE -43.479 -32.167 -33.689 -29.330
Ligands - glycine SAM TPP
Gene PPP2R5D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 7.001 14.002
Length SE - 0. 0. 0.
Lev Distance - 36. 38. 35.
UBS 10. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 2. 1. 1. 1.
H 3. 3. 3. 3.
BL 6. 4. 4. 4.
BR 5. 3. 4. 3.
UN 0.225 0.198 0.198 0.270

Sequences

Field Description
UTR seq + 25 gagacgccgagcgggccgagugcggccgagcaaagccggagccggagcggggccgcaggagacgggccggguccggacgggccgagATGCCCTATAAACTGAAAAAGGAGA
UTR dot + 25 ….(.(((.((.(((((….)))))..))…..))).)(((((.(.((.((((….).))).)).).)))))..((((……))))……………….
RS 1 seq GGACGAUACUCUGGAGAGACCCGUUGAAUCGGGCGCCGAAGGAGCAAGGCACCGUGAUUGCAUCGCAAUCUGGCGCCGGAAACUCUCAGGCAAAAGGACAGAGGGGAUGGG
RS 1 dot ……..((((((…(.((((……))))).))…))))…(((.(((.((((((…))))))))).)))…..(((((.(………).)))))……
RS 2 seq UUCUUAUCAAGAGAGGUGGAGGGACUUGGCCCUGCGAAGCCUCAGCAACCAGCAAACCGCGGUUUGUAUGGUGCUAAUUCCGGAGGGACGGAACCGUCCUGAAGAUGAGAA
RS 2 dot …………((((((.((((……)))).)…)))))(((.(((((((((……))))).)))))))..(((.(((.((……)).))).)))……..
RS 3 seq AAAAAACCACGCGGGAGCACACACCAAGUGCGCUGAGAGGACGGAUCGGGGCCGUCGACCGUAUGAACCUGACCGGGUAAUGCCGGCGUAGGGAGAUGAAUAAUGACUGAA
RS 3 dot ……((.(.(((..((((…….)))).))).).))((((.((((…..))))))))…..((((.((((……))))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table