Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084035 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA084035
Gene: PPWD1
MFE: -20.747
ENS: 0.932
Length: 97.
Predicted Ligands:
TPP - 7/20
purine - 5/20
SAM - 3/20
 RS: URS0000C87F46_1423776
MFE: -19.349
Ligand: SAM
Species: Lactobacillus odoratitofui DSM 19909 = JCM 15043 SMK box translational riboswitch (SAM-III)
 RS: URS00007E28F7_80854
MFE: -8.083
Ligand: unknown
Species: Moritella viscosa gcvT riboswitch element
 RS: URS0000D8F54C_1302250
MFE: -21.753
Ligand: SAM
Species: Lactobacillus silagei JCM 19001 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084035 URS0000C87F46_1423776 URS00007E28F7_80854 URS0000D8F54C_1302250
Length 97. 97. 95. 97.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.932 - - -
MFE -20.747 -19.349 -8.083 -21.753
Ligands - SAM unknown SAM
Gene PPWD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 2.001 5.
Length SE - 0. 4. 0.
Lev Distance - 24. 21. 25.
UBS 5. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 1. 2. 1. 1.
H 2. 2. 2. 2.
BL 1. 0. 1. 1.
BR 0. 1. 1. 2.
UN 0.144 0.082 0.179 0.124

Sequences

Field Description
UTR seq + 25 agaagacugcgccgcugcuuugggauugguagcugaguuuugugucgcgccuuuucugacgaugcgaacaacATGAAGGTGTTTGATGTAGTGAACT
UTR dot + 25 ..((((((.((..((((((……..))))))))))))))..(((((((((((………………..))))))))..)))……….
RS 1 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUUGACUUAGUGAAGAUGCCUUGUAACCGAAAAACGAAUUGGGGGAAUUUUUUAUUAUG
RS 1 dot ..(((((((((((((((……))..))))))).))))))….(((((((((..(((…..((((……..)))))))…)))))))))..
RS 2 seq UUUUUUUGCGUACUUUCACGUCUGCUUUUUGCUGUGGCUUUUGCUGUGGUUUUUUUGCUUCGUUUACCCAUCUUGAAUAAUUACAUCCUCCUCAG
RS 2 dot …….(((…..(((((…((…..)))))))….)))(((((((.(((……………….))).)))))))……….
RS 3 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUUGACUUAGUGAAGAUGCCUUGUAACCGAAAAAAGAUAUUGGGGGAAUUUUUACAAUG
RS 3 dot ..(((((((((((((((……))..))))))).))))))……((((((((.(((…..((((………))))))).))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table