Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084055 Similarity: 0.948 Similarity: 0.946 Similarity: 0.944
UTR: 5HSAA084055
Gene: PPWD1_0
MFE: -37.015
ENS: 0.825
Length: 193.
Predicted Ligands:
cobalamin - 11/20
TPP - 4/20
Mn2+ - 2/20
 RS: URS0002314B81_142842
MFE: -38.854
Ligand: cobalamin
Species: Selenihalanaerobacter shriftii Cobalamin riboswitch
 RS: URS000231BD5A_883109
MFE: -48.742
Ligand: cobalamin
Species: Eubacterium infirmum F0142 Cobalamin riboswitch
 RS: URS0002326332_866536
MFE: -38.523
Ligand: cobalamin
Species: Belliella baltica DSM 15883 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084055 URS0002314B81_142842 URS000231BD5A_883109 URS0002326332_866536
Length 193. 193. 191. 192.
Similarity - 0.948 0.946 0.944
Ensemble Norm 0.825 - - -
MFE -37.015 -38.854 -48.742 -38.523
Ligands - cobalamin cobalamin cobalamin
Gene PPWD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.001 12.006 10.001
Length SE - 0. 4. 1.
Lev Distance - 62. 60. 69.
UBS 12. 12. 14. 14.
BS 0. 0. 0. 0.
ILL 1. 3. 0. 3.
ILR 3. 5. 4. 2.
H 3. 3. 4. 4.
BL 5. 3. 6. 5.
BR 5. 3. 3. 5.
UN 0.155 0.192 0.079 0.130

Sequences

Field Description
UTR seq + 25 uuaaaaaucuuucacuaguuauuuuguacauagauaagauaguugauucccagcuuuuaucuguaaaguugucauaauuggaauuaacuucggugauucuguuguauaaaacauuguuauauuuuuaggugugugcggauuuuaggcaaacaagaaaauauuagagugATGAAGGTGTTTGATGTAGTGAACT
UTR dot + 25 …………………(((((((((((((((.((.(((((((((((((((((…….)))))))……..))))))))))))..))..))))).))))))))((((.(.((((((((…(((.(((………))).))).)))))))).).))))……..((((……..)))).
RS 1 seq AUAUGAAUUUAUAUUUUAGGUUUAAUAGAAAUCUCACUGUUAAUUAAAAGGGAAGAACGGUGUAAAUCCGUCACGGUCCCACCACUGUAACUAGUAGAUUUAAUUUAUUAUACCACUUAGAUUAUUAUCUAGGGAAGGCUGCUUUUAAUCUUAAACUAGGAGUCAGGAGACCUGCCUAAAGUAUUAGUAAUAU
RS 1 dot ………………(((.((((((((((((.(((((((…….((((…((((…….))))…..))))…….)))).))))))))…))))))).))).(((((((….)))))))..((((.((((((..(((((…)))))…))))).)..))))…………….
RS 2 seq UUUAAUACGUUGGAUUUCAGUGCGGAUUGGCGCGUGCCAUGAUGUUAAAAGGAAAUCAGGUGAAAGUCCUGAGCAAUCCGGUUACUGUAAUCAUCUUACUAAUCCCCUAAUUAUGUCAUUGCGCACGACGUGAGAAGGCUUGGGGAGAUAUGGGUGAGAGCCAGGAAACCUGCUGAAUUUUGGUGAGUUCU
RS 2 dot …………((((.(((((((((((.((.((((((.((((………..))))))))…….)).))))))))..))))).))))..((((((.((((((((((((((((………)))))))……)))))).)))…))))))((.((((…))))))((((((….)))))).
RS 3 seq UCUAUAUCAUCCGGAAUUGGUUAUGCUUAGGUGUGUAUUAAAAGGGAAUCGUGUGCAAAUCACGAACUGUCGCGCAACUGUAAGUAACAAUCCAAAGGUUUUUGUCCUAGUAUGUCCACUGUUUUAAAUAAAAUGGGAAGGACGACAAAAGCUGUUACAAGUCAGGAGACCUGCCUAUUUCGAUAUGACGAU
RS 3 dot …………((.((((….(((((((((((((…….((.(.(((((…….)))))..).))))))).)).)))))).))))))…((((((((((…….((((.(((((((….)))))))…))))))))))))))……((.((((…)))).))…(((……))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table