Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084057 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA084057
Gene: PPWD1_1
MFE: -18.529
ENS: 0.918
Length: 93.
Predicted Ligands:
guanidine - 10/20
TPP - 4/20
glycine - 2/20
 RS: URS00021EDB86_1469950
MFE: -43.128
Ligand: guanidine
Species: Robinsoniella sp. KNHs210 guanidine-IV riboswitch
 RS: URS0000D7A431_657014
MFE: -30.657
Ligand: TPP
Species: Phaeobacter sp. G4 TPP riboswitch (THI element)
 RS: URS00021EDE79_12908
MFE: -40.550
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084057 URS00021EDB86_1469950 URS0000D7A431_657014 URS00021EDE79_12908
Length 93. 92. 95. 92.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.918 - - -
MFE -18.529 -43.128 -30.657 -40.550
Ligands - guanidine TPP guanidine
Gene PPWD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 2.005 4.
Length SE - 1. 4. 1.
Lev Distance - 25. 23. 27.
UBS 5. 4. 6. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 2. 1. 2. 1.
H 2. 2. 2. 2.
BL 1. 2. 1. 1.
BR 1. 1. 1. 0.
UN 0.075 0.033 0.147 0.065

Sequences

Field Description
UTR seq + 25 gacugcgccgcugcuuugggauugguagcugaguuuugugucgcgccuuuucugacgaugcgaacaacATGAAGGTGTTTGATGTAGTGAACT
UTR dot + 25 …….(.((((((……..)))))).)(((((((((((((((((((………………..))))))))..))))))..)))))
RS 1 seq UUACAUGCGUCGCCGGAUGCAUGUAUCAUAAAUAAGCAUCGGACAUCUAUACCGUUAGGCCAUUGGGUAUAGAUGACUGGUGCUUUUUUUGU
RS 1 dot .((((((((((….))))))))))..(((((.(((((((((.((((((((((…………)))))))))).)))))))))..)))))
RS 2 seq ACGUUGUGACAGGGGCGUCCGGAUUGCCGGGCUGAGAAGCACCCUUUGAACCUGAACCAGAUCAUGCUGGCGGAGGAAGUCGCGGUUUCAGCCCC
RS 2 dot ………….((((…….))))(((((((((.((((((((((……..((((……))))))))))..)).))..))))))))).
RS 3 seq AAUUAUCUGCCGCCGGGUAGAUCAAGAAACAAAGCAUGUGCGCCCCUAUCGUUAGGCCUGAGAAGAUAGGGGAGAGCGCAUGCUUUUUUGUU
RS 3 dot ….(((((((….)))))))(((((….((((((((((.((((((((…………..))))))))…)))))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table