Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084288 Similarity: 0.950 Similarity: 0.947 Similarity: 0.947
UTR: 5HSAA084288
Gene: PRDX3
MFE: -33.473
ENS: 0.952
Length: 183.
Predicted Ligands:
cobalamin - 11/20
lysine - 7/20
glycine - 1/20
 RS: URS0002321E64_1904966
MFE: -80.809
Ligand: cobalamin
Species: Ornithinimicrobium sp. CNJ-824 Cobalamin riboswitch
 RS: URS0000AB9BF2_657319
MFE: -53.583
Ligand: lysine
Species: Eubacterium siraeum 70/3 Lysine riboswitch
 RS: URS000232E688_1838281
MFE: -78.355
Ligand: cobalamin
Species: Streptomyces sp. SolWspMP-5a-2 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084288 URS0002321E64_1904966 URS0000AB9BF2_657319 URS000232E688_1838281
Length 183. 182. 183. 181.
Similarity - 0.950 0.947 0.947
Ensemble Norm 0.952 - - -
MFE -33.473 -80.809 -53.583 -78.355
Ligands - cobalamin lysine cobalamin
Gene PRDX3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 5. 27.001
Length SE - 1. 0. 4.
Lev Distance - 59. 69. 53.
UBS 11. 13. 11. 13.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 2.
ILR 1. 3. 1. 4.
H 5. 4. 5. 5.
BL 2. 2. 2. 5.
BR 4. 5. 2. 2.
UN 0.131 0.121 0.148 0.094

Sequences

Field Description
UTR seq + 25 agaaccaauccccccacagguggcaaaggaugacugugccuaagauguacaguugaaccgaauguuuugauuuauacuaagcacuuuauacuacuaauuaauuaugagaaguuuaaauaaaaucauaggugcuugacauagcaaaugaugaacuccauATGGCGGCTGCTGTAGGACGGTTGC
UTR dot + 25 ……….((((….)).))(((((.((((((((((…….))))))))…….)).)))))……..((((((((……………..(((((……………)))))))))))))……((.(((……..))).))(((((((((…)).)))))))
RS 1 seq GACACCCCGGUCGACGUCGGUCGCACCCCGUGUGCAAAGGGAAUCCGGUCCAAAUCCGGAGCUGACGCGCAGCGGUAGGGGUGACGGCCGGGGCGGACACGCCACUGGGCUCAUGGUGCCCGGGAAGGUGCCCCGGUCGGACGAUCCCGAGCCCGAAGACCUGCCGACGUCGUUGGUGAGGG
RS 1 dot ……..(((((((….)))).)))((((((((….((..(((((…….))))).))…))))).)))..((((((.((((((((((……(((.((((((…….))))))…)))))))))))))..).)))))………..(((((((((…)))))).))).
RS 2 seq AAAGCAGGUAGAGGUGCGAUUAAAGAAAAGUACCCGUUGCGUCAAUCUGCCGACAGAUUGCAGCGGGAAAAGGCUUUGUCGCCGAAGAACAUAAGUGUCGGAGCUUAUGUAUCUGGUCGUGUGUCUAAUAUAUGCACGAUUGUCAUCAAGCGGUUAAGCUGUAGGUGGAGAGCUAUCACACAA
RS 2 dot ………….(.((((.(((((…….(((((((((…(((((….))))))))))))))……))))))))))..(((((((((((……)))))))).)))((((((((((…….))))))))))……..(((((…)))))..(((((……)).)))..
RS 3 seq UAUAUAGUCGGGGGCAAAGGUCCGCGGUGCAGGGAAGCCGGUGUGAGUCCGGCACGGUCCCGCCACUGUGACCGGGGAGCGCGCCGUCGAACGACACGCCACUGACGAGCACCAGGUCGGGAAGGCGGACGGCGCGCGCAGAUCCGGGAGUCAGGAUACCGGCCGCGGAACGUUCCGUGUU
RS 3 dot ……..((.((((….)))).))(((..((((.(((((…….)))))….))))..)))…..((((((.((((((((((……..((((.(((((………)))))…)))))))))))))).)…)))))..(((.((…)))))((((((….))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table