Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084384 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA084384
Gene: PRG4
MFE: -14.722
ENS: 0.990
Length: 76.
Predicted Ligands:
fluoride - 16/20
SAM - 3/20
cobalamin - 1/20
 RS: URS0000DB2A72_1798420
MFE: -12.573
Ligand: SAM
Species: Ignavibacteria bacterium GWA2_54_16 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000DA358A_1802357
MFE: -12.218
Ligand: fluoride
Species: Tenericutes bacterium RIFOXYB2_FULL_36_25 Fluoride riboswitch
 RS: URS0000D92B7E_180163
MFE: -11.440
Ligand: fluoride
Species: Cetobacterium ceti Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084384 URS0000DB2A72_1798420 URS0000DA358A_1802357 URS0000D92B7E_180163
Length 76. 77. 76. 76.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.990 - - -
MFE -14.722 -12.573 -12.218 -11.440
Ligands - SAM fluoride fluoride
Gene PRG4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.013 7.025 7.011
Length SE - 1. 0. 0.
Lev Distance - 18. 19. 20.
UBS 3. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 1. 0. 0. 0.
H 1. 2. 3. 3.
BL 0. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.263 0.377 0.421 0.368

Sequences

Field Description
UTR seq + 25 aaacucaucuauccuuuacggcaaggguaccuacgguaccugaaaacaacgATGGCATGGAAAACACTTCCCATTT
UTR dot + 25 ….(((((((((………..(((((((…)))))))………))))).))))…………….
RS 1 seq AUUUUCCAGUGUGGCAAUUUGAACGACAGCUUGCGGCCACAUUAAAAAAAUGCUAAAGCGUCUGUGCGGAAUCAACA
RS 1 dot …….((((((((………………..))))))))……((((….))))…………….
RS 2 seq CAUAGAAGAGGGAAUGAACGUCUCCCUUAGUCAACCAUGACUAAAACCGCAACAUGCUAAUGACUUCUACAACACG
RS 2 dot ………((((………))))(((((((….)))))))….(((…)))……………….
RS 3 seq UAAUAAAGAGGGAAUGAAGUUCUCCCUUAGUUUUGCAACUAAAACCGCUUAUUUAGCUGAUGACUUCUACGACUUU
RS 3 dot …….((((((………)))))).((((((….)))))).(((…..)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table