Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084404 Similarity: 0.981 Similarity: 0.980 Similarity: 0.978
UTR: 5HSAA084404
Gene: PRIM1
MFE: -20.675
ENS: 0.965
Length: 89.
Predicted Ligands:
zmp-ztp - 9/20
glycine - 5/20
homocysteine - 2/20
RS: URS0000C621B3_1736380
MFE: -30.397
Ligand: glycine
Species: Rhizobium sp. Leaf453 Glycine riboswitch
RS: URS0000D91DFF_63
MFE: -30.957
Ligand: homocysteine
Species: Vitreoscilla filiformis S-adenosyl-L-homocysteine riboswitch
RS: URS000080DF21_210007
MFE: -26.393
Ligand: tetrahydrofolate
Species: tetrahydrofolate riboswitch aptamer from Streptococcus mutans UA159 (PDB 6Q57, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084404 URS0000C621B3_1736380 URS0000D91DFF_63 URS000080DF21_210007
Length 89. 88. 89. 89.
Similarity - 0.981 0.980 0.978
Ensemble Norm 0.965 - - -
MFE -20.675 -30.397 -30.957 -26.393
Ligands - glycine homocysteine tetrahydrofolate
Gene PRIM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.001 14.003
Length SE - 1. 0. 0.
Lev Distance - 22. 26. 24.
UBS 8. 10. 8. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 1.
ILR 2. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 3. 4. 4.
BR 3. 4. 2. 1.
UN 0.124 0.114 0.146 0.180

Sequences

Field Description
UTR seq + 25 ccgccggccgugcuguucccgccaauuccugugguaauccuuaccguggcgaguuccgcgcucaATGGAGACGTTTGACCCCACCGAGC
UTR dot + 25 ………..((.(..(.(((((…….((((((…))))))))))).)..).))((((..(((.(……..).)))..))))
RS 1 seq CCGAUCUUGUUGGGAGAAUCCGGUUUGCGCCGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCCCAUGGACCAGCAAGGUGCC
RS 1 dot ……….((((((..(((((…(.(.(((((((….).))).))))))))))..))))))(((((.((……)).)).)))
RS 2 seq CUUUCCGAGGAGCGCUGCGAGAGGACACGGUGGCCGGGCCGCCACCUCCCAGGCUCGGAGAGCCUUGUAUCCAACCGCGCUCACCCUGC
RS 2 dot ………((((.(((.(.((((….((((((…)))))).))))))))))))((.((((…((…..))…)))).))….
RS 3 seq GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCAUCCGCUCCA
RS 3 dot …………..((((.((..((.((((((.((((….)))))))))))).))))))(((((.((((……..)))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table