Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084408 Similarity: 0.973 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA084408
Gene: PRIM1_1
MFE: -36.619
ENS: 0.918
Length: 110.
Predicted Ligands:
TPP - 11/20
GMP - 2/20
methionine - 2/20
 RS: URS0002318B94_712122
MFE: -60.767
Ligand: zmp-ztp
Species: Actinomyces sp. oral taxon 414 ZMP/ZTP riboswitch
 RS: URS0000D6BD4A_12908
MFE: -42.069
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GCG riboswitch
 RS: URS0000D78896_1839754
MFE: -49.001
Ligand: methionine
Species: Candidatus Frankia californiensis S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084408 URS0002318B94_712122 URS0000D6BD4A_12908 URS0000D78896_1839754
Length 110. 110. 110. 111.
Similarity - 0.973 0.973 0.973
Ensemble Norm 0.918 - - -
MFE -36.619 -60.767 -42.069 -49.001
Ligands - zmp-ztp GMP methionine
Gene PRIM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.001 2.002
Length SE - 0. 0. 1.
Lev Distance - 35. 35. 34.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 4. 4. 3. 5.
BR 4. 3. 4. 3.
UN 0.045 0.073 0.082 0.090

Sequences

Field Description
UTR seq + 25 agcgccugcgcagucgcggggccgccggccgugcuguucccgccaauuccugugguaauccuuaccguggcgaguuccgcgcucaATGGAGACGTTTGACCCCACCGAGC
UTR dot + 25 .(((….)))….(((((((((((.((.(((..(((.((((……..)))).)))…))).)))))).)))))))((((..(((.(……..).)))..))))
RS 1 seq GCGCGUCGUCGCGACUGGCGCAAAGGUGGUCACCACCGGGGAGCGGCGGCGCCGCGCCGGAUCGCCCGGGGCGGCCAUCACGAACCUGGUCGCCCGCCUGGGCCGAGGUC
RS 1 dot ((((((((…))))..))))…(((((((.((.(((((((.(((((……)))))..)).))))))).)))))))….((((.(..((((….))))).)))).
RS 2 seq UCACCGCCGGGAAGCGAUGAUCCUCGAGGGGAGCUGACGGUCGCUCGGACGAGGCCUCGGCCUCACCCGCCCAUCGAGGGGAGCCAGUGGCGAGCCCGACCCGGGAGUGC
RS 2 dot (((.(((……))).)))((((((((((..(.(((.(((((…((……)).)))))))).)..))).)))))))………(((..((((…))))..)))
RS 3 seq GGGCCCGAACGUCAGCGUCAAGUCCUGGUUCGCUGGUCGGUGACCCUCGUUCACGGUCGGGUGUUCCAGAUGAGAGCCCCGCGCGACGAACCAGUCGCGCGGGCGGGUGUC
RS 3 dot .(((……))).((.((..((.((((..((((.(.(.((((…….)))).).).))))..))))))..))))((((((((((……))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table