Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084601 Similarity: 0.989 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA084601
Gene: PRKAR2B_0
MFE: -14.645
ENS: 0.729
Length: 44.
Predicted Ligands:
SAM - 10/20
preQ_1 - 7/20
zmp-ztp - 1/20
 RS: URS0000DAF0C0_505341
MFE: -5.883
Ligand: preQ_1
Species: Gallibacterium salpingitidis PreQ1 riboswitch
 RS: URS000232AFD4_1797678
MFE: -15.
Ligand: zmp-ztp
Species: Clostridiales bacterium GWC2_40_7 ZMP/ZTP riboswitch
 RS: URS0000D80EF9_1552123
MFE: -6.806
Ligand: preQ_1
Species: Listeria booriae PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084601 URS0000DAF0C0_505341 URS000232AFD4_1797678 URS0000D80EF9_1552123
Length 44. 45. 43. 45.
Similarity - 0.989 0.988 0.987
Ensemble Norm 0.729 - - -
MFE -14.645 -5.883 -15. -6.806
Ligands - preQ_1 zmp-ztp preQ_1
Gene PRKAR2B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 7.002 12.002
Length SE - 1. 1. 1.
Lev Distance - 12. 13. 12.
UBS 5. 4. 4. 3.
BS 0. 0. 0. 0.
ILL 3. 1. 1. 1.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 1. 1. 2. 1.
BR 3. 2. 2. 1.
UN 0.045 0.067 0. 0.089

Sequences

Field Description
UTR seq + 25 cugccgccccggaggcaggATGAGCATCGAGATCCCGGCGGGAC
UTR dot + 25 .(.(((((..(((..(..(((….)))..).))).))))).).
RS 1 seq AUUGUCGUGGUUCGCAAACCUCCCACGUUAAAAAACUAGGAACAU
RS 1 dot ..((((.(((((….(((…….)))….))))).)).)).
RS 2 seq GUCGUGCGACUGGCGGAAGUGGAUUAACCACAGGGAGCACGAC
RS 2 dot (((((((..((.(.((………..)).).))..)))))))
RS 3 seq GUUUCCGUGGUUCGAAACUAUCCCACGAUAAAAAACUAAGGAGUG
RS 3 dot ..((((.(((((……((((….))))…))))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table