Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084724 Similarity: 0.953 Similarity: 0.946 Similarity: 0.943
UTR: 5HSAA084724
Gene: PRKCZ
MFE: -66.383
ENS: 0.830
Length: 198.
Predicted Ligands:
cobalamin - 16/20
SAM - 2/20
lysine - 2/20
 RS: URS00023181CC_54914
MFE: -56.399
Ligand: cobalamin
Species: Brevibacillus parabrevis Cobalamin riboswitch
 RS: URS00019B3DD9_2653164
MFE: -73.682
Ligand: cobalamin
Species: Pseudomonas sp. 8BK Cobalamin
 RS: URS00019D16C6_2653165
MFE: -65.903
Ligand: cobalamin
Species: Pseudomonas sp. 8O Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084724 URS00023181CC_54914 URS00019B3DD9_2653164 URS00019D16C6_2653165
Length 198. 198. 198. 197.
Similarity - 0.953 0.946 0.943
Ensemble Norm 0.830 - - -
MFE -66.383 -56.399 -73.682 -65.903
Ligands - cobalamin cobalamin cobalamin
Gene PRKCZ - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 13. 12.
Length SE - 0. 0. 1.
Lev Distance - 63. 65. 68.
UBS 15. 14. 13. 14.
BS 0. 0. 0. 0.
ILL 6. 6. 6. 8.
ILR 6. 7. 4. 5.
H 3. 3. 3. 2.
BL 3. 3. 2. 2.
BR 2. 2. 4. 4.
UN 0.061 0.111 0.061 0.081

Sequences

Field Description
UTR seq + 25 agagcauaaagaaucugcgcugaggaggcaggagaagaaagccgagagcguacugcggucagugcagcgagaggauauggggccucgcgaggcaaggcuacaggugcaucaacugcaaacugcugguccauaagcgcugccacggccucgucccgcugaccugcaggaagcauATGCTCACCCCGAGGACGGATGAAT
UTR dot + 25 .(.((……..(((((.((….)))))))……..)))..(((((((((((((((((((……..((((..((((((..(((..((..((((((((.((((…..))))..))).)))))…..))..)))…)))))))))))))))))).))))……)))))))…(((….)))……
RS 1 seq AAGAAUAGCAUGCAGCUAGGUGCCUUUGCGAGAGCAAGGGGUAACAGGGAAUCGGGUGAAAAUCCCGAGCGGUCCCGCCACUGUAAUUGGUGAGUUCUCUUUCCAACAUGUCACUCGGUAUGGAGCAUGUCCAUCGGGGAAGACGAAAGAGCGCGAUGAGCCAAAAGCCAGGAGACCUACCUAGUUUGUCACACCCGU
RS 1 dot …..((((…..))))….(((((((….)))))))…………((((((…….(((((((((…((…((..(((((..((((((((((……(((.(((.(.(((((…..)))))).)))..))))))))))…)))..)))))..))..)).))))……)))))…)))))).
RS 2 seq UAGCCUUGUCGCGUUCGAGGUUCUUCGUGGGCAUGCCCAUGAAGCUAAGAGGGAACAGGGUGAAUGCCCUGGCUGCCCCCGCAACUGUGAACGGUCCAAAGCCCUUCGAUACACCACUGCCGUACGGCGGGAAGGUAGAAGGGUGGCGCAACGCGCAGACCGUGAGCCAGGAGACCUGCCUCGCCAUGUUUUCGACAA
RS 2 dot .(((((((…….)))))))(((((((((….)))))))))……(((((((.(((((..(((((((((…..(((..(((((….((((…(((((((…..(((.(((((….)))))…))).))))))))).))….)))))…))))))))))……)).))))).)))))))…..
RS 3 seq UAGCCUUCUCGCUUUCGAGGUUCUUCCCGGCAAGCGGCUGGGGAGCUAAGAGGGAACAGGGUCGAUGCCCUGGCUGCCCCCGCAACUGUGAACGGUCUUAAACCCUUCGAUACACCACUGCCGUAGGGCGGGAAGGUGAAGGACGCGCAACGCGCAGACCGUGAGCCAGGAGACCUGCCUCGACUGACCAGCCAACU
RS 3 dot …(((..((.((((..((…(((((((((…..))))))))))).)))).))..)))(((((.(((((((((…..(((..(((((..(((((((….(((((………(((((….))))))))))…))))).))…..)))))…))))))))))……)).)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table