Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084852 Similarity: 0.957 Similarity: 0.954 Similarity: 0.954
UTR: 5HSAA084852
Gene: PRMT1
MFE: -56.139
ENS: 0.966
Length: 154.
Predicted Ligands:
glucosamine - 12/20
cobalamin - 5/20
molybdenum - 1/20
 RS: URS0000D7EA3C_1897028
MFE: -61.426
Ligand: glucosamine
Species: Firmicutes bacterium CAG:129_59_24 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C4806C_1390249
MFE: -35.040
Ligand: glucosamine
Species: Desulfuribacillus stibiiarsenatis glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000DAD4A3_1261635
MFE: -41.413
Ligand: glucosamine
Species: Roseburia sp. 831b glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084852 URS0000D7EA3C_1897028 URS0000C4806C_1390249 URS0000DAD4A3_1261635
Length 154. 153. 153. 152.
Similarity - 0.957 0.954 0.954
Ensemble Norm 0.966 - - -
MFE -56.139 -61.426 -35.040 -41.413
Ligands - glucosamine glucosamine glucosamine
Gene PRMT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 14.003 14.
Length SE - 1. 1. 4.
Lev Distance - 54. 55. 51.
UBS 9. 11. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 2. 3. 4. 4.
H 3. 3. 3. 3.
BL 4. 3. 4. 4.
BR 3. 3. 3. 3.
UN 0.032 0.098 0.092 0.039

Sequences

Field Description
UTR seq + 25 auugccaaugaaaucuuccagcggggucgcgguaggcgggccguggacccucugguauaaggcggucccgggggagugaggagaaagggggggucuuggcggccggaggaggaguaggugcgggugaagATGGCGGCAGCCGAGGCCGCGAACT
UTR dot + 25 ((((((.(((…….((((.(((..((((((……))))))..))).)))))))..))))))(((……………..)))(.(((((((((.((((……………………….)))).))))))))).)…..
RS 1 seq UCUCCAUCAUAAGCGCCAGCGCCCGCCUUUGGCGGGACGACGAGGUGGGAAGAGGAUCGAAAUUUCGGCGGAUGCUUCCCCGUGCCCGUGGGCGCGCACACAGCCGACAAACAUGCGGGCGACCGCAGAACAAAGGGGCUGUGACCACGGGAA
RS 1 dot ..(((.((…..((((.(((((((((…)))))).)).)..))))….)))))………(((.(((….))))))..(((((((…….(((((((……..(((((….)))))………))))))).)))))))..
RS 2 seq UGUAUGUCAAUAGCGCCAGGACUGAAUAUUCAGUUGACGAGGUGAAGGUGAUCGAACAAUUCGGCGGAUGCCUUCCAGUAUUAGCCUAUGCUGCAAGAGAUGAACGAAAAACAUUGGGCGACCAGUGGAUACAAGGGACUCUCAAGGCUAAGU
RS 2 dot (((.(((((.(..((((.(((((((….))))))..)..))))..).))).)).)))….(((….)))……..(((((((.((…..((((…………((((((….))))))………..)))))))))))))..
RS 3 seq CUUUUCCAUUUAGCGCCAUGUACCUGCGUUGACAGGUUGACGAGGAGAAGGGUGAUCGAAAAUUCGGCGGAUGCCCUUCCGUGGACUUCCCUGCGAGAUAUACCGGCAAAUAUGCGGGUGACUGCAAAACAAAUACGGUAUAAGGAAGAUGA
RS 3 dot .((((((((((..(.((.((((((((……)))))..))).)).)..)))))…))))).((.(((((……))))).))(((.(((……(((((((…….(((((….)))))………)))))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table