Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA084926 Similarity: 0.989 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA084926
Gene: PROCA1
MFE: -12.145
ENS: 0.807
Length: 47.
Predicted Ligands:
preQ_1 - 9/20
SAM - 7/20
glutamine - 3/20
RS: URS0000D99644_574375
MFE: -11.087
Ligand: SAM
Species: Bacillus gaemokensis SAM riboswitch (S box leader)
RS: URS0000E6098E_150033
MFE: -9.981
Ligand: unknown
Species: Enterococcus ratti DUF1646 RNA
RS: URS00021EDCFA_12908
MFE: -7.492
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA084926 URS0000D99644_574375 URS0000E6098E_150033 URS00021EDCFA_12908
Length 47. 48. 48. 46.
Similarity - 0.989 0.989 0.989
Ensemble Norm 0.807 - - -
MFE -12.145 -11.087 -9.981 -7.492
Ligands - SAM unknown SAM
Gene PROCA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.014 4. 8.
Length SE - 1. 1. 1.
Lev Distance - 11. 12. 11.
UBS 4. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 1. 1. 0.
H 1. 1. 1. 1.
BL 0. 0. 1. 1.
BR 1. 0. 1. 2.
UN 0.255 0.375 0.250 0.261

Sequences

Field Description
UTR seq + 25 acgaagaccugggcggagagcgATGTGGGTCAGGACGACGCTCACAA
UTR dot + 25 ………((((((..(..((((….))).)..)..))))))…
RS 1 seq UACUUAUCCAGAGAGGUAGAGGGACUGGCCCUAUGAAACCUCAGCAGC
RS 1 dot …………(((((..((((…..))))…..)))))……
RS 2 seq GGUUGGGCUUAUGCUUCAAGGAUUGCGUUCUUCAAGGGGUGAGAAGAA
RS 2 dot …….(((((.(((..((((……))))..))).)))))…..
RS 3 seq CGAUUGCAACGGCUUCAUGACGUGAUCGCUUAAUCUUUUUGGAGCA
RS 3 dot ………..((((((.((…(((……))).)).)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table