Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085231 Similarity: 0.976 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA085231
Gene: PRRT1
MFE: -49.571
ENS: 0.870
Length: 129.
Predicted Ligands:
cobalamin - 9/20
glycine - 4/20
tetrahydrofolate - 3/20
 RS: URS0000DA99A1_1834192
MFE: -29.340
Ligand: tetrahydrofolate
Species: Enterococcus sp. 9D6_DIV0238 THF riboswitch
 RS: URS0000D86DAB_314722
MFE: -54.383
Ligand: homocysteine
Species: Pseudoxanthomonas suwonensis S-adenosyl-L-homocysteine riboswitch
 RS: URS00023127F9_1415558
MFE: -44.627
Ligand: cobalamin
Species: Streptomyces sp. WM6386 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085231 URS0000DA99A1_1834192 URS0000D86DAB_314722 URS00023127F9_1415558
Length 129. 128. 129. 129.
Similarity - 0.976 0.974 0.973
Ensemble Norm 0.870 - - -
MFE -49.571 -29.340 -54.383 -44.627
Ligands - tetrahydrofolate homocysteine cobalamin
Gene PRRT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 2.009 12.001
Length SE - 1. 0. 0.
Lev Distance - 27. 35. 32.
UBS 6. 7. 6. 7.
BS 3. 3. 4. 4.
ILL 1. 1. 1. 2.
ILR 1. 3. 1. 4.
H 2. 2. 2. 2.
BL 3. 4. 2. 3.
BR 2. 0. 2. 2.
UN 0.132 0.164 0.225 0.109

Sequences

Field Description
UTR seq + 25 aggguaaugggugcuuuauuuugagaagccauagguaaaaauugugcuuuuaaagccacucugccagccgcccaacgcugguaggcugggagagggucagagugATGCCGGGCACCCAGACTCCAGCAC
UTR dot + 25 .((((..(((((((((((((((((((((.(((((…….))))))))))…(((.((((.((((((..(((….)))..)))))).)))))))))))))))…..)))))))).))))……
RS 1 seq AACAGAGUAGGAAAUAAAGCGUCAAGUGCUGAAAGGAUGGGAUGUUGCCUUUCGGACGAAGUAUGAGGUAAAAGAAGCACGAGCUGGCUUUUCUAAUCAUACGCGGUUUUGUUUUCGCAUUCGCUGCA
RS 1 dot ….((((.(((((((((((..(..((.((((((((..(…..)..))))))))))…((((((((.(((((.(((….)))..)))))))..)))))))..)))))))))))..))))……
RS 2 seq CCCGCCGAGGGGCGCUGCGACCGUGGACCGGGCGGGACUUCCGCCGGAACCCGCACCGAGGUGCGGAGCUUUCCGAUCCACGGCCAGGCUCGGCAUGGCACACCCUAGCGACAACGGCGCCCGGCGAAA
RS 2 dot ..((((…((((((((….(((((..((((((((..((((…))))))))).)))..((((.((((((.(((…..)))..)))))).))))…….))..)))….))))))))))))…
RS 3 seq AUGCUCAUGCUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUCAUGCGUGCAUAAGCACAUAUGAGAGUCAGUCCGAGGACCUGUCGACAGUGCGCCCAGGCC
RS 3 dot ..(((…((.((((((((..((((((((.(((((…….)))))….)))).(..(((((..((((((.((((….)))).))))))…))..)))..)..)))))))))))).))…))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table