Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085279 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA085279
Gene: PRSS27
MFE: -14.802
ENS: 1.
Length: 66.
Predicted Ligands:
fluoride - 17/20
SAM - 1/20
cobalamin - 1/20
 RS: URS0000D6CA44_441165
MFE: -21.135
Ligand: fluoride
Species: Burkholderia thailandensis TXDOH Fluoride riboswitch
 RS: URS0000BE6302_267608
MFE: -19.635
Ligand: fluoride
Species: Ralstonia solanacearum GMI1000 Fluoride riboswitch
 RS: URS0000C4153C_1315976
MFE: -17.543
Ligand: fluoride
Species: Plesiomonas shigelloides 302-73 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085279 URS0000D6CA44_441165 URS0000BE6302_267608 URS0000C4153C_1315976
Length 66. 67. 67. 67.
Similarity - 0.982 0.981 0.980
Ensemble Norm 1. - - -
MFE -14.802 -21.135 -19.635 -17.543
Ligands - fluoride fluoride fluoride
Gene PRSS27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.050 7.072 0.128
Length SE - 1. 1. 1.
Lev Distance - 21. 23. 26.
UBS 2. 4. 4. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 1. 0. 0.
H 2. 3. 3. 2.
BL 0. 1. 1. 0.
BR 0. 0. 1. 0.
UN 0.045 0.269 0.313 0.403

Sequences

Field Description
UTR seq + 25 cugucucaaaaaauuaaaaaaaauaauaauaauaauaaugaATGAGGCGGCCGGCGGCGGTGCCGC
UTR dot + 25 ((((((((…………………………….))))))))…(((((…)))))
RS 1 seq ACGGCAACCGGAGAUGGCAUGCCUCCGUACAACCGCCGGCGAGCCGGCUGAUGAUGCCUACGCGUUC
RS 1 dot ..((((.(((….)))..))))………..(((((….)))))….(((((….))))).
RS 2 seq CCGGCCUGCGGAGAUGGCAUGCCUCCCUUAACCGCCGAUCCCAUCGGCUGAUGAUGCCUACAGGUUC
RS 2 dot ..(((.(((…….))).)))……….((((((…))))))…….(((….)))..
RS 3 seq UGCCAUCGUGGAGAUGGCAUUCCUCCCUUAACCGUCGGGUUUCCCGUCUGAUGAUGCCUGCUAGAUU
RS 3 dot (((((((…..)))))))………….(((((((…….)))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table