Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085448 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA085448
Gene: PSMA3
MFE: -18.040
ENS: 0.945
Length: 71.
Predicted Ligands:
fluoride - 9/20
cobalamin - 8/20
glycine - 2/20
 RS: URS00022CD256_219649
MFE: -20.774
Ligand: fluoride
Species: Paraburkholderia unamae Fluoride
 RS: URS0000D85E3D_1434837
MFE: -30.719
Ligand: cobalamin
Species: Nocardiopsis sp. JB363 Cobalamin riboswitch
 RS: URS0000BE7EDF_1179773
MFE: -29.882
Ligand: cobalamin
Species: Saccharothrix espanaensis DSM 44229 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085448 URS00022CD256_219649 URS0000D85E3D_1434837 URS0000BE7EDF_1179773
Length 71. 72. 70. 71.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.945 - - -
MFE -18.040 -20.774 -30.719 -29.882
Ligands - fluoride cobalamin cobalamin
Gene PSMA3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.023 4. 2.002
Length SE - 1. 1. 0.
Lev Distance - 17. 18. 20.
UBS 4. 3. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 2. 0. 2. 2.
H 2. 2. 2. 2.
BL 0. 0. 1. 0.
BR 0. 0. 1. 0.
UN 0.155 0.306 0.143 0.197

Sequences

Field Description
UTR seq + 25 gcgcuccgggccuggaaucccuacgcgucccuuuggguuuagcacgATGAGCTCAATCGGCACTGGGTATG
UTR dot + 25 ((((…(((……..)))…))))((..(((((((((……)))))))))..))………..
RS 1 seq UGAGAUCGCGGAGAUGGCAUUCUCCCUCAACCGUCGCGCUUCCCCUGUGCGGCUAAUGAUGCCUACGGACCC
RS 1 dot ((((…..(((((……)))))))))…(((((((…….)))))))……………….
RS 2 seq GGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUGACCGGGGGAGGACCCCGGAAGUCAGGUCACC
RS 2 dot ((((.(((((…….)))))….))))….((((..((((((…..))))))..).)))……
RS 3 seq GGGGAAGCCGGUCGAAAUCCGGCGCUGACCCGCAACGGUAGGCCCCCUCAUCGGGGCGAGCCCGACCACCC
RS 3 dot (((..(((..((((…..)))))))..)))…..(((..(((((……)))))..)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table